BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3230260.2.1
         (863 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AW497843.1|AW497843  PC02H08 Pine TriplEx pollen cone lib...    42   0.037
gb|DR016036.1|DR016036  STRS1_7_F08.b1_A034 Shoot tip pitch ...    42   0.037
gb|DR694315.1|DR694315  EST1084407 Normalized pine embryo li...    42   0.037
gb|DT638664.1|DT638664  EST1153595 Normalized pine embryo li...    42   0.037

>gb|AW497843.1|AW497843 PC02H08 Pine TriplEx pollen cone library Pinus taeda cDNA clone
           PC02H08, mRNA sequence
          Length = 365

 Score = 42.1 bits (21), Expect = 0.037
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 190 aagtagtagcagcagcagcag 210
           |||||||||||||||||||||
Sbjct: 181 aagtagtagcagcagcagcag 201



>gb|DR016036.1|DR016036 STRS1_7_F08.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
           cDNA clone STRS1_7_F08_A034 3', mRNA sequence
          Length = 898

 Score = 42.1 bits (21), Expect = 0.037
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 191 agtagtagcagcagcagcagc 211
           |||||||||||||||||||||
Sbjct: 719 agtagtagcagcagcagcagc 699



>gb|DR694315.1|DR694315 EST1084407 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PWAEA83 3' end, mRNA sequence
          Length = 824

 Score = 42.1 bits (21), Expect = 0.037
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 190 aagtagtagcagcagcagcag 210
           |||||||||||||||||||||
Sbjct: 181 aagtagtagcagcagcagcag 201



>gb|DT638664.1|DT638664 EST1153595 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PIMHH88 3' end, mRNA sequence
          Length = 831

 Score = 42.1 bits (21), Expect = 0.037
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 190 aagtagtagcagcagcagcag 210
           |||||||||||||||||||||
Sbjct: 189 aagtagtagcagcagcagcag 209



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 129,065
Number of Sequences: 355925
Number of extensions: 129065
Number of successful extensions: 37943
Number of sequences better than  0.5: 4
Number of HSP's better than  0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37931
Number of HSP's gapped (non-prelim): 8
length of query: 863
length of database: 217,277,237
effective HSP length: 19
effective length of query: 844
effective length of database: 210,514,662
effective search space: 177674374728
effective search space used: 177674374728
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)