BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3199064.2.1
(589 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|DR690595.1|DR690595 EST1080681 Normalized pine embryo li... 50 1e-004
gb|DT636185.1|DT636185 EST1151116 Normalized pine embryo li... 50 1e-004
dbj|BD235995.1| Materials and method for modification of pl... 46 0.002
gb|BG040013.1|BG040013 NXSI_105_D08_F NXSI (Nsf Xylem Side ... 42 0.025
gb|CO162170.1|CO162170 FLD1_33_C12.g1_A029 Root flooded Pin... 42 0.025
gb|DR025229.1|DR025229 STRS1_70_H11.b1_A034 Shoot tip pitch... 42 0.025
dbj|BD236026.1| Materials and method for modification of pl... 40 0.099
gb|BX251481.1|BX251481 BX251481 Pinus pinaster differenciat... 38 0.39
gb|BX252531.1|BX252531 BX252531 Pinus pinaster differenciat... 38 0.39
gb|BX255621.1|BX255621 BX255621 Pinus pinaster differenciat... 38 0.39
gb|BE209183.1|BE209183 NXNV_147_A11_F Nsf Xylem Normal wood... 38 0.39
gb|CO160719.1|CO160719 FLD1_23_D04.g1_A029 Root flooded Pin... 38 0.39
gb|CO161082.1|CO161082 FLD1_26_C02.g1_A029 Root flooded Pin... 38 0.39
gb|CO164697.1|CO164697 FLD1_49_E08.g1_A029 Root flooded Pin... 38 0.39
gb|CX646807.1|CX646807 COLD1_11_D10.g1_A029 Root cold Pinus... 38 0.39
gb|CX651969.1|CX651969 COLD1_56_C01.b1_A029 Root cold Pinus... 38 0.39
gb|CX713086.1|CX713086 RTPQ1_6_H09.g1_A032 Roots treated wi... 38 0.39
gb|DR017070.1|DR017070 STRS1_13_H07.g1_A034 Shoot tip pitch... 38 0.39
gb|DR022214.1|DR022214 STRS1_49_D01.g1_A034 Shoot tip pitch... 38 0.39
gb|DR070028.1|DR070028 RTDK1_10_G09.g1_A029 Roots, dark Pin... 38 0.39
gb|DR079650.1|DR079650 RTFEPL1_12_D08.g1_A029 Roots plus ad... 38 0.39
gb|DR097105.1|DR097105 STRR1_32_C03.g1_A033 Stem Response R... 38 0.39
gb|DR169398.1|DR169398 RTPHOS1_32_D06.b1_A029 Roots minus p... 38 0.39
gb|DR384947.1|DR384947 RTHG1_5_D12.g1_A029 Roots plus added... 38 0.39
gb|DT634818.1|DT634818 EST1149749 Normalized pine embryo li... 38 0.39
emb|AJ309093.1|PPI309093 Pinus pinaster partial mRNA for pu... 38 0.39
gb|AY531555.1| Pinus pinaster putative sucrose synthase gen... 38 0.39
>gb|DR690595.1|DR690595 EST1080681 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWACW88 3' end, mRNA sequence
Length = 676
Score = 50.1 bits (25), Expect = 1e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 202 tcttctccatggcaagactcgacagggtgaagaacataacagggctggt 250
||||||| ||||||||||||||| ||||||| || || ||||| |||||
Sbjct: 522 tcttctctatggcaagactcgaccgggtgaaaaatatgacaggactggt 570
>gb|DT636185.1|DT636185 EST1151116 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMGO90 3' end, mRNA sequence
Length = 726
Score = 50.1 bits (25), Expect = 1e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 202 tcttctccatggcaagactcgacagggtgaagaacataacagggctggt 250
||||||| ||||||||||||||| ||||||| || || ||||| |||||
Sbjct: 643 tcttctctatggcaagactcgaccgggtgaaaaatatgacaggactggt 691
Score = 40.1 bits (20), Expect = 0.099
Identities = 41/48 (85%)
Strand = Plus / Plus
Query: 21 gatgtcttcgatccaaagttcaatatagtctctcctggagctgacatg 68
||||| || |||||||| ||||| || || ||||||||||| ||||||
Sbjct: 462 gatgtttttgatccaaaattcaacattgtttctcctggagcagacatg 509
>dbj|BD235995.1| Materials and method for modification of plant cell wall
polysaccharides
Length = 477
Score = 46.1 bits (23), Expect = 0.002
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| ||||||||||| |||||
Sbjct: 267 tgagggagctggttaaccttgtcgtggttgc 297
Score = 42.1 bits (21), Expect = 0.025
Identities = 48/57 (84%)
Strand = Plus / Plus
Query: 12 catgggatcgatgtcttcgatccaaagttcaatatagtctctcctggagctgacatg 68
||||| || ||||| || ||||| |||||||| || || ||||||||||| ||||||
Sbjct: 2 catggaattgatgtttttgatcccaagttcaacattgtttctcctggagcagacatg 58
Score = 38.2 bits (19), Expect = 0.39
Identities = 34/39 (87%)
Strand = Plus / Plus
Query: 191 aaagcccatcctcttctccatggcaagactcgacagggt 229
||||||||| |||| || ||||||||||||||| ||||
Sbjct: 181 aaagcccattatcttttctatggcaagactcgaccgggt 219
>gb|BG040013.1|BG040013 NXSI_105_D08_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_105_D08 5' similar to Arabidopsis thaliana
sequence At4g02280 putative sucrose synthetase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 528
Score = 42.1 bits (21), Expect = 0.025
Identities = 48/57 (84%)
Strand = Plus / Plus
Query: 12 catgggatcgatgtcttcgatccaaagttcaatatagtctctcctggagctgacatg 68
||||| || ||||| || ||||| |||||||| || || ||||||||||| ||||||
Sbjct: 92 catggaattgatgtttttgatcccaagttcaacattgtttctcctggagcagacatg 148
Score = 40.1 bits (20), Expect = 0.099
Identities = 53/64 (82%)
Strand = Plus / Plus
Query: 191 aaagcccatcctcttctccatggcaagactcgacagggtgaagaacataacagggctggt 250
||||||||| |||| || ||||||||||||||| |||| || || || ||||| ||||
Sbjct: 271 aaagcccattatcttttctatggcaagactcgaccgggttaaaaatatgacaggattggt 330
Query: 251 cgaa 254
||||
Sbjct: 331 cgaa 334
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
|||||||| |||| ||||||||||| |||||
Sbjct: 357 tgagggagttggttaaccttgtcgtggttgc 387
>gb|CO162170.1|CO162170 FLD1_33_C12.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_33_C12_A029 5', mRNA sequence
Length = 853
Score = 42.1 bits (21), Expect = 0.025
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 202 tcttctccatggcaagactcgacagggtgaagaacataacagggctggt 250
||||||| |||||||||||||| ||||||| || || ||||| |||||
Sbjct: 669 tcttctctatggcaagactcgatcgggtgaaaaatatgacaggactggt 717
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 744 tgagggagctggttaaccttgttgtggttgc 774
>gb|DR025229.1|DR025229 STRS1_70_H11.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_70_H11_A034 3', mRNA sequence
Length = 861
Score = 42.1 bits (21), Expect = 0.025
Identities = 42/49 (85%)
Strand = Plus / Minus
Query: 202 tcttctccatggcaagactcgacagggtgaagaacataacagggctggt 250
||||||| |||||||||||||| ||||||| || || ||||| |||||
Sbjct: 271 tcttctctatggcaagactcgatcgggtgaaaaatatgacaggactggt 223
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Minus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 196 tgagggagctggttaaccttgttgtggttgc 166
>dbj|BD236026.1| Materials and method for modification of plant cell wall
polysaccharides
Length = 1169
Score = 40.1 bits (20), Expect = 0.099
Identities = 53/64 (82%)
Strand = Plus / Plus
Query: 191 aaagcccatcctcttctccatggcaagactcgacagggtgaagaacataacagggctggt 250
||||||||| |||| || ||||||||||||||| |||| || || || ||||| ||||
Sbjct: 248 aaagcccattatcttttctatggcaagactcgaccgggttaaaaatatgacaggattggt 307
Query: 251 cgaa 254
||||
Sbjct: 308 cgaa 311
Score = 40.1 bits (20), Expect = 0.099
Identities = 41/48 (85%)
Strand = Plus / Plus
Query: 21 gatgtcttcgatccaaagttcaatatagtctctcctggagctgacatg 68
||||| || ||||| |||||||| || || ||||||||||| ||||||
Sbjct: 78 gatgtttttgatcccaagttcaacattgtttctcctggagcagacatg 125
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
|||||||| |||| ||||||||||| |||||
Sbjct: 334 tgagggagttggttaaccttgtcgtggttgc 364
>gb|BX251481.1|BX251481 BX251481 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP050B05 similar to SUCROSE SYNTHASE, mRNA
sequence
Length = 701
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 10 tgagggagctggttaaccttgttgtggttgc 40
>gb|BX252531.1|BX252531 BX252531 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP066B03 similar to SUCROSE SYNTHASE, mRNA
sequence
Length = 712
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
|||||||| |||| ||||||||||| |||||
Sbjct: 226 tgagggagttggttaaccttgtcgtggttgc 256
Score = 38.2 bits (19), Expect = 0.39
Identities = 34/39 (87%)
Strand = Plus / Plus
Query: 191 aaagcccatcctcttctccatggcaagactcgacagggt 229
||||||||| |||| || ||||||||||||||| ||||
Sbjct: 140 aaagcccattatcttttctatggcaagactcgaccgggt 178
>gb|BX255621.1|BX255621 BX255621 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP007G11 similar to SUCROSE SYNTHASE, mRNA
sequence
Length = 706
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 343 tgagggagctggttaaccttgttgtggttgc 373
>gb|BE209183.1|BE209183 NXNV_147_A11_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_147_A11 5' similar to Arabidopsis thaliana
sequence At3g43190 sucrose synthase like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 524
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 97 tgagggagctggttaaccttgttgtggttgc 127
>gb|CO160719.1|CO160719 FLD1_23_D04.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_23_D04_A029 5', mRNA sequence
Length = 723
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 78 tgagggagctggttaaccttgttgtggttgc 108
>gb|CO161082.1|CO161082 FLD1_26_C02.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_26_C02_A029 5', mRNA sequence
Length = 865
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 44 tgagggagctggttaaccttgttgtggttgc 74
>gb|CO164697.1|CO164697 FLD1_49_E08.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_49_E08_A029 5', mRNA sequence
Length = 885
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 345 tgagggagctggttaaccttgttgtggttgc 375
>gb|CX646807.1|CX646807 COLD1_11_D10.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_11_D10_A029 5', mRNA sequence
Length = 870
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 178 tgagggagctggttaaccttgttgtggttgc 208
>gb|CX651969.1|CX651969 COLD1_56_C01.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_56_C01_A029 3', mRNA sequence
Length = 653
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Minus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 643 tgagggagctggttaaccttgttgtggttgc 613
>gb|CX713086.1|CX713086 RTPQ1_6_H09.g1_A032 Roots treated with paraquat Pinus taeda cDNA
clone RTPQ1_6_H09_A032 5', mRNA sequence
Length = 829
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 499 tgagggagctggttaaccttgttgtggttgc 529
>gb|DR017070.1|DR017070 STRS1_13_H07.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_13_H07_A034 5', mRNA sequence
Length = 379
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 280 tgagggagctggttaaccttgttgtggttgc 310
>gb|DR022214.1|DR022214 STRS1_49_D01.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_49_D01_A034 5', mRNA sequence
Length = 585
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 54 tgagggagctggttaaccttgttgtggttgc 84
>gb|DR070028.1|DR070028 RTDK1_10_G09.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_10_G09_A029 5', mRNA sequence
Length = 734
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 349 tgagggagctggttaaccttgttgtggttgc 379
>gb|DR079650.1|DR079650 RTFEPL1_12_D08.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_12_D08_A029 5', mRNA sequence
Length = 845
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 445 tgagggagctggttaaccttgttgtggttgc 475
>gb|DR097105.1|DR097105 STRR1_32_C03.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_32_C03_A033 5', mRNA sequence
Length = 743
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 354 tgagggagctggttaaccttgttgtggttgc 384
>gb|DR169398.1|DR169398 RTPHOS1_32_D06.b1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_32_D06_A029 3', mRNA sequence
Length = 554
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Minus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 359 tgagggagctggttaaccttgttgtggttgc 329
>gb|DR384947.1|DR384947 RTHG1_5_D12.g1_A029 Roots plus added mercury Pinus taeda cDNA clone
RTHG1_5_D12_A029 5', mRNA sequence
Length = 787
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 499 tgagggagctggttaaccttgttgtggttgc 529
>gb|DT634818.1|DT634818 EST1149749 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMGA12 3' end, mRNA sequence
Length = 817
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 101 tgagggagctggttaaccttgttgtggttgc 131
>emb|AJ309093.1|PPI309093 Pinus pinaster partial mRNA for putative sucrose synthase
Length = 787
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 382 tgagggagctggttaaccttgttgtggttgc 412
>gb|AY531555.1| Pinus pinaster putative sucrose synthase gene, partial sequence
Length = 991
Score = 38.2 bits (19), Expect = 0.39
Identities = 28/31 (90%)
Strand = Plus / Plus
Query: 277 tgagggagctggtaaaccttgtcgtcgttgc 307
||||||||||||| |||||||| || |||||
Sbjct: 946 tgagggagctggttaaccttgttgtggttgc 976
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 49,074
Number of Sequences: 355925
Number of extensions: 49074
Number of successful extensions: 12233
Number of sequences better than 0.5: 27
Number of HSP's better than 0.5 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12174
Number of HSP's gapped (non-prelim): 59
length of query: 589
length of database: 217,277,237
effective HSP length: 19
effective length of query: 570
effective length of database: 210,514,662
effective search space: 119993357340
effective search space used: 119993357340
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)