BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3115474.2.1
(798 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO198621.1|CO198621 GEO1_15_E06.b1_A029 Root gravitropis... 66 2e-009
gb|DR052754.1|DR052754 RTCA1_6_E01.g1_A029 Roots minus calc... 66 2e-009
gb|CF399989.1|CF399989 RTWW1_2_C12.g1_A015 Well-watered lob... 54 9e-006
gb|CO173085.1|CO173085 NDL1_33_H09.g1_A029 Needles control ... 54 9e-006
gb|DR081108.1|DR081108 RTFEPL1_27_A10.g1_A029 Roots plus ad... 54 9e-006
dbj|BD266974.1| Compositions isolated from plant cells and ... 54 9e-006
>gb|CO198621.1|CO198621 GEO1_15_E06.b1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_15_E06_A029 3', mRNA sequence
Length = 724
Score = 65.9 bits (33), Expect = 2e-009
Identities = 66/77 (85%)
Strand = Plus / Plus
Query: 30 acataaccatccatttcagatttcaagcattgttcatgtgtcgcctggataacatctgct 89
||||||||||||||| || |||| |||||| |||||||| |||||||||||||| ||
Sbjct: 477 acataaccatccattccacatttagagcattcctcatgtgttgcctggataacatcagca 536
Query: 90 gtcatggctaatattgg 106
||||| || ||||||||
Sbjct: 537 gtcattgccaatattgg 553
Score = 46.1 bits (23), Expect = 0.002
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 207 tcaaatccatccatttcaggcatctgtatgtccatgaaacaagcatcaaaattgtgagg 265
||||| ||||||||||| ||||| |||| |||||||| || |||||||| || |||||
Sbjct: 657 tcaaacccatccatttctggcatttgtacatccatgaagcatgcatcaaacttatgagg 715
>gb|DR052754.1|DR052754 RTCA1_6_E01.g1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_6_E01_A029 5', mRNA sequence
Length = 836
Score = 65.9 bits (33), Expect = 2e-009
Identities = 66/77 (85%)
Strand = Plus / Minus
Query: 30 acataaccatccatttcagatttcaagcattgttcatgtgtcgcctggataacatctgct 89
||||||||||||||| || |||| |||||| |||||||| |||||||||||||| ||
Sbjct: 169 acataaccatccattccacatttagagcattcctcatgtgttgcctggataacatcagca 110
Query: 90 gtcatggctaatattgg 106
||||| || ||||||||
Sbjct: 109 gtcattgccaatattgg 93
>gb|CF399989.1|CF399989 RTWW1_2_C12.g1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_2_C12_A015 5', mRNA sequence
Length = 754
Score = 54.0 bits (27), Expect = 9e-006
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 204 gcttcaaatccatccatttcaggcatctgtatgtccatgaaacaagcatcaaaattgtg 262
|||||||| ||||||||||| |||||||| | ||||||||||| |||| ||||||||
Sbjct: 393 gcttcaaacccatccatttctggcatctgcacatccatgaaacatgcattgaaattgtg 335
>gb|CO173085.1|CO173085 NDL1_33_H09.g1_A029 Needles control Pinus taeda cDNA clone
NDL1_33_H09_A029 5', mRNA sequence
Length = 771
Score = 54.0 bits (27), Expect = 9e-006
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 204 gcttcaaatccatccatttcaggcatctgtatgtccatgaaacaagcatcaaaattgtg 262
|||||||| ||||||||||| |||||||| | ||||||||||| |||| ||||||||
Sbjct: 667 gcttcaaacccatccatttctggcatctgcacatccatgaaacatgcattgaaattgtg 609
>gb|DR081108.1|DR081108 RTFEPL1_27_A10.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_27_A10_A029 5', mRNA sequence
Length = 747
Score = 54.0 bits (27), Expect = 9e-006
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 204 gcttcaaatccatccatttcaggcatctgtatgtccatgaaacaagcatcaaaattgtg 262
|||||||| ||||||||||| |||||||| | ||||||||||| |||| ||||||||
Sbjct: 560 gcttcaaacccatccatttctggcatctgcacatccatgaaacatgcattgaaattgtg 502
>dbj|BD266974.1| Compositions isolated from plant cells and utilization of the same
in modifying plant cell signal transduction
Length = 1489
Score = 54.0 bits (27), Expect = 9e-006
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 204 gcttcaaatccatccatttcaggcatctgtatgtccatgaaacaagcatcaaaattgtg 262
|||||||| ||||||||||| |||||||| | ||||||||||| |||| ||||||||
Sbjct: 981 gcttcaaacccatccatttctggcatctgcacatccatgaaacatgcattgaaattgtg 923
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 107,890
Number of Sequences: 355925
Number of extensions: 107890
Number of successful extensions: 27709
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27702
Number of HSP's gapped (non-prelim): 7
length of query: 798
length of database: 217,277,237
effective HSP length: 19
effective length of query: 779
effective length of database: 210,514,662
effective search space: 163990921698
effective search space used: 163990921698
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)