BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3115184.2.3
         (1548 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CX712902.1|CX712902  RTPQ1_5_C07.g1_A032 Roots treated wi...    40   0.27 
gb|DR021278.1|DR021278  STRS1_43_C07.g1_A034 Shoot tip pitch...    40   0.27 

>gb|CX712902.1|CX712902 RTPQ1_5_C07.g1_A032 Roots treated with paraquat Pinus taeda cDNA
           clone RTPQ1_5_C07_A032 5', mRNA sequence
          Length = 798

 Score = 40.1 bits (20), Expect = 0.27
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 348 ttgtacttgatgtcgacgtt 367
           ||||||||||||||||||||
Sbjct: 747 ttgtacttgatgtcgacgtt 766



>gb|DR021278.1|DR021278 STRS1_43_C07.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
           cDNA clone STRS1_43_C07_A034 5', mRNA sequence
          Length = 711

 Score = 40.1 bits (20), Expect = 0.27
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 429 gtgttggaggtgccgtggat 448
           ||||||||||||||||||||
Sbjct: 498 gtgttggaggtgccgtggat 517



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 160,798
Number of Sequences: 355925
Number of extensions: 160798
Number of successful extensions: 50848
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50846
Number of HSP's gapped (non-prelim): 2
length of query: 1548
length of database: 217,277,237
effective HSP length: 20
effective length of query: 1528
effective length of database: 210,158,737
effective search space: 321122550136
effective search space used: 321122550136
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)