BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2950290.2.2
(867 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE761852.1|BE761852 NXCI_070_F02_F NXCI (Nsf Xylem Compr... 58 6e-007
gb|BE761802.1|BE761802 NXCI_070_A03_F NXCI (Nsf Xylem Compr... 54 1e-005
gb|BE761839.1|BE761839 NXCI_070_D10_F NXCI (Nsf Xylem Compr... 54 1e-005
gb|BE761869.1|BE761869 NXCI_070_G10_F NXCI (Nsf Xylem Compr... 54 1e-005
gb|BG040254.1|BG040254 NXSI_110_C07_F NXSI (Nsf Xylem Side ... 54 1e-005
gb|BG040315.1|BG040315 NXSI_110_H11_F NXSI (Nsf Xylem Side ... 54 1e-005
gb|BE761819.1|BE761819 NXCI_070_B08_F NXCI (Nsf Xylem Compr... 52 4e-005
gb|BG040263.1|BG040263 NXSI_110_D07_F NXSI (Nsf Xylem Side ... 46 0.002
gb|BQ634756.1|BQ634756 NXRV072_H04_F NXRV (Nsf Xylem Root w... 46 0.002
gb|BE761818.1|BE761818 NXCI_070_B07_F NXCI (Nsf Xylem Compr... 44 0.009
gb|BE761834.1|BE761834 NXCI_070_D05_F NXCI (Nsf Xylem Compr... 44 0.009
gb|BG040234.1|BG040234 NXSI_110_A09_F NXSI (Nsf Xylem Side ... 44 0.009
gb|BG040240.1|BG040240 NXSI_110_B01_F NXSI (Nsf Xylem Side ... 44 0.009
gb|BG040264.1|BG040264 NXSI_110_D02_F NXSI (Nsf Xylem Side ... 44 0.009
gb|BG040277.1|BG040277 NXSI_110_E06_F NXSI (Nsf Xylem Side ... 44 0.009
gb|BG040290.1|BG040290 NXSI_110_F07_F NXSI (Nsf Xylem Side ... 44 0.009
gb|BG040304.1|BG040304 NXSI_110_G10_F NXSI (Nsf Xylem Side ... 44 0.009
gb|BQ696827.1|BQ696827 NXPV_045_G09_F NXPV (Nsf Xylem Plani... 44 0.009
gb|BE761866.1|BE761866 NXCI_070_G06_F NXCI (Nsf Xylem Compr... 42 0.037
gb|BG040235.1|BG040235 NXSI_110_A10_F NXSI (Nsf Xylem Side ... 42 0.037
gb|BG040270.1|BG040270 NXSI_110_E02_F NXSI (Nsf Xylem Side ... 42 0.037
gb|BG040271.1|BG040271 NXSI_110_D10_F NXSI (Nsf Xylem Side ... 42 0.037
gb|BG040303.1|BG040303 NXSI_110_G12_F NXSI (Nsf Xylem Side ... 42 0.037
gb|BG040309.1|BG040309 NXSI_110_H05_F NXSI (Nsf Xylem Side ... 42 0.037
gb|BQ696835.1|BQ696835 NXPV_045_H12_F NXPV (Nsf Xylem Plani... 42 0.037
gb|BE761803.1|BE761803 NXCI_070_A04_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761804.1|BE761804 NXCI_070_A02_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761805.1|BE761805 NXCI_070_A01_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761806.1|BE761806 NXCI_070_A06_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761807.1|BE761807 NXCI_070_A07_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761808.1|BE761808 NXCI_070_A08_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761809.1|BE761809 NXCI_070_A09_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761810.1|BE761810 NXCI_070_A10_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761812.1|BE761812 NXCI_070_B01_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761813.1|BE761813 NXCI_070_B02_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761814.1|BE761814 NXCI_070_B03_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761815.1|BE761815 NXCI_070_B04_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761816.1|BE761816 NXCI_070_B05_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761817.1|BE761817 NXCI_070_B06_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761820.1|BE761820 NXCI_070_B10_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761821.1|BE761821 NXCI_070_B11_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761822.1|BE761822 NXCI_070_B12_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761823.1|BE761823 NXCI_070_C01_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761824.1|BE761824 NXCI_070_C02_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761825.1|BE761825 NXCI_070_C03_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761826.1|BE761826 NXCI_070_C05_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761827.1|BE761827 NXCI_070_C04_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761828.1|BE761828 NXCI_070_C06_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761829.1|BE761829 NXCI_070_C07_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761830.1|BE761830 NXCI_070_D01_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761831.1|BE761831 NXCI_070_D02_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761832.1|BE761832 NXCI_070_D03_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761833.1|BE761833 NXCI_070_D04_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761835.1|BE761835 NXCI_070_D06_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761836.1|BE761836 NXCI_070_D07_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761837.1|BE761837 NXCI_070_D08_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761838.1|BE761838 NXCI_070_D09_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761840.1|BE761840 NXCI_070_D11_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761841.1|BE761841 NXCI_070_D12_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761842.1|BE761842 NXCI_070_E01_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761843.1|BE761843 NXCI_070_E02_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761844.1|BE761844 NXCI_070_E03_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761845.1|BE761845 NXCI_070_E04_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761846.1|BE761846 NXCI_070_E05_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761847.1|BE761847 NXCI_070_E06_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761848.1|BE761848 NXCI_070_E10_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761849.1|BE761849 NXCI_070_E11_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761850.1|BE761850 NXCI_070_E12_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761851.1|BE761851 NXCI_070_F01_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761853.1|BE761853 NXCI_070_F03_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761854.1|BE761854 NXCI_070_F04_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761855.1|BE761855 NXCI_070_F05_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761856.1|BE761856 NXCI_070_F06_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761857.1|BE761857 NXCI_070_F07_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761858.1|BE761858 NXCI_070_F08_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761859.1|BE761859 NXCI_070_F09_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761860.1|BE761860 NXCI_070_F10_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761861.1|BE761861 NXCI_070_F11_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761862.1|BE761862 NXCI_070_F12_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761863.1|BE761863 NXCI_070_G01_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761864.1|BE761864 NXCI_070_G04_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761865.1|BE761865 NXCI_070_G05_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761867.1|BE761867 NXCI_070_G07_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761868.1|BE761868 NXCI_070_G09_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761870.1|BE761870 NXCI_070_G12_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761871.1|BE761871 NXCI_070_H02_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761872.1|BE761872 NXCI_070_H04_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761873.1|BE761873 NXCI_070_H05_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761874.1|BE761874 NXCI_070_H06_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761875.1|BE761875 NXCI_070_H07_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761876.1|BE761876 NXCI_070_H09_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BE761877.1|BE761877 NXCI_070_H10_F NXCI (Nsf Xylem Compr... 40 0.15
gb|BG040225.1|BG040225 NXSI_110_A11_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040226.1|BG040226 NXSI_110_A03_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040227.1|BG040227 NXSI_110_A04_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040228.1|BG040228 NXSI_110_A05_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040229.1|BG040229 NXSI_110_A07_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040230.1|BG040230 NXSI_110_A01_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040231.1|BG040231 NXSI_110_A08_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040232.1|BG040232 NXSI_110_A02_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040233.1|BG040233 NXSI_110_B05_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040236.1|BG040236 NXSI_110_A12_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040237.1|BG040237 NXSI_110_B02_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040238.1|BG040238 NXSI_110_B07_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040239.1|BG040239 NXSI_110_B04_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040241.1|BG040241 NXSI_110_B09_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040242.1|BG040242 NXSI_110_B06_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040243.1|BG040243 NXSI_110_B11_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040245.1|BG040245 NXSI_110_B08_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040246.1|BG040246 NXSI_110_C05_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040247.1|BG040247 NXSI_110_B12_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040248.1|BG040248 NXSI_110_B10_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040249.1|BG040249 NXSI_110_C03_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040250.1|BG040250 NXSI_110_C04_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040251.1|BG040251 NXSI_110_C01_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040252.1|BG040252 NXSI_110_C08_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040255.1|BG040255 NXSI_110_C11_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040256.1|BG040256 NXSI_110_C06_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040257.1|BG040257 NXSI_110_C10_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040258.1|BG040258 NXSI_110_C09_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040259.1|BG040259 NXSI_110_D04_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040260.1|BG040260 NXSI_110_C12_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040261.1|BG040261 NXSI_110_E07_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040262.1|BG040262 NXSI_110_D01_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040265.1|BG040265 NXSI_110_D05_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040266.1|BG040266 NXSI_110_D09_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040267.1|BG040267 NXSI_110_D06_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040268.1|BG040268 NXSI_110_D11_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040269.1|BG040269 NXSI_110_D08_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040273.1|BG040273 NXSI_110_D12_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040274.1|BG040274 NXSI_110_E04_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040275.1|BG040275 NXSI_110_E03_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040279.1|BG040279 NXSI_110_E05_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040280.1|BG040280 NXSI_110_E09_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040283.1|BG040283 NXSI_110_F03_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040284.1|BG040284 NXSI_110_E11_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040285.1|BG040285 NXSI_110_F04_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040286.1|BG040286 NXSI_110_F01_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040287.1|BG040287 NXSI_110_F02_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040288.1|BG040288 NXSI_110_F05_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040289.1|BG040289 NXSI_110_F09_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040291.1|BG040291 NXSI_110_F06_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040292.1|BG040292 NXSI_110_F08_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040293.1|BG040293 NXSI_110_F12_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040295.1|BG040295 NXSI_110_F11_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040296.1|BG040296 NXSI_110_G03_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040297.1|BG040297 NXSI_110_G02_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040298.1|BG040298 NXSI_110_G01_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040299.1|BG040299 NXSI_110_H02_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040300.1|BG040300 NXSI_110_G04_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040301.1|BG040301 NXSI_110_G06_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040302.1|BG040302 NXSI_110_G08_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040306.1|BG040306 NXSI_110_G11_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040308.1|BG040308 NXSI_110_H01_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040312.1|BG040312 NXSI_110_H06_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040313.1|BG040313 NXSI_110_H07_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BG040317.1|BG040317 NXSI_110_H10_F NXSI (Nsf Xylem Side ... 40 0.15
gb|BQ696832.1|BQ696832 NXPV_045_H07_F NXPV (Nsf Xylem Plani... 40 0.15
gb|BQ696834.1|BQ696834 NXPV_045_H09_F NXPV (Nsf Xylem Plani... 40 0.15
gb|CX647752.1|CX647752 COLD1_19_G12.g1_A029 Root cold Pinus... 40 0.15
gb|DR015405.1|DR015405 STRS1_3_G09.b1_A034 Shoot tip pitch ... 40 0.15
gb|DR015493.1|DR015493 STRS1_3_G09.g1_A034 Shoot tip pitch ... 40 0.15
gb|DR092120.1|DR092120 RTAL1_26_C03.g1_A029 Roots plus adde... 40 0.15
gb|DR385091.1|DR385091 RTHG1_6_C08.g1_A029 Roots plus added... 40 0.15
gb|DR689144.1|DR689144 EST1079230 Normalized pine embryo li... 40 0.15
gb|DT634416.1|DT634416 EST1149347 Normalized pine embryo li... 40 0.15
gb|DT635000.1|DT635000 EST1149931 Normalized pine embryo li... 40 0.15
>gb|BE761852.1|BE761852 NXCI_070_F02_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_F02 5' similar to Arabidopsis
thaliana sequence At1g76940 hypothetical protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 450
Score = 58.0 bits (29), Expect = 6e-007
Identities = 32/33 (96%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaatcctgcagcccgggggatc 867
||||| |||||||||||||||||||||||||||
Sbjct: 77 aacctcgtgccgaatcctgcagcccgggggatc 45
>gb|BE761802.1|BE761802 NXCI_070_A03_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_A03 5' similar to Arabidopsis
thaliana sequence At1g79040 unknown protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 454
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
|||||||||||||||||||||||||||
Sbjct: 67 gtgccgaatcctgcagcccgggggatc 41
>gb|BE761839.1|BE761839 NXCI_070_D10_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_D10 5' similar to Arabidopsis
thaliana sequence At2g02500 2-C-methyl-D-erythritol
4-phosphate cytidyltransferase (ATMEPCT) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 502
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
|||||||||||||||||||||||||||
Sbjct: 71 gtgccgaatcctgcagcccgggggatc 45
>gb|BE761869.1|BE761869 NXCI_070_G10_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_G10 5', mRNA sequence
Length = 382
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
|||||||||||||||||||||||||||
Sbjct: 70 gtgccgaatcctgcagcccgggggatc 44
>gb|BG040254.1|BG040254 NXSI_110_C07_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_C07 5' similar to Arabidopsis thaliana
sequence At1g14670 endomembrane protein, putative see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 618
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
|||||||||||||||||||||||||||
Sbjct: 68 gtgccgaatcctgcagcccgggggatc 42
>gb|BG040315.1|BG040315 NXSI_110_H11_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_H11 5' similar to Arabidopsis thaliana
sequence At5g59310 nonspecific lipid-transfer protein
precursor - like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 588
Score = 54.0 bits (27), Expect = 1e-005
Identities = 27/27 (100%)
Strand = Plus / Minus
Query: 841 gtgccgaatcctgcagcccgggggatc 867
|||||||||||||||||||||||||||
Sbjct: 75 gtgccgaatcctgcagcccgggggatc 49
>gb|BE761819.1|BE761819 NXCI_070_B08_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_B08 5', mRNA sequence
Length = 486
Score = 52.0 bits (26), Expect = 4e-005
Identities = 36/38 (94%), Gaps = 1/38 (2%)
Strand = Plus / Minus
Query: 831 aacgaacctggtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||| ||||||||||||||||||
Sbjct: 85 aacgaacctcgtgccgaattcctgcagcccgggggatc 48
>gb|BG040263.1|BG040263 NXSI_110_D07_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_D07 5', mRNA sequence
Length = 492
Score = 46.1 bits (23), Expect = 0.002
Identities = 33/35 (94%), Gaps = 1/35 (2%)
Strand = Plus / Minus
Query: 834 gaacctggtgccgaat-cctgcagcccgggggatc 867
|||||| ||||||||| ||||||||||||||||||
Sbjct: 76 gaacctcgtgccgaattcctgcagcccgggggatc 42
>gb|BQ634756.1|BQ634756 NXRV072_H04_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV072_H04 5', mRNA sequence
Length = 731
Score = 46.1 bits (23), Expect = 0.002
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaatcctgcagcccgg 861
||||| |||||||||||||||||||||
Sbjct: 27 aacctcgtgccgaatcctgcagcccgg 1
>gb|BE761818.1|BE761818 NXCI_070_B07_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_B07 5' similar to Arabidopsis
thaliana sequence At1g05810 RAS-related protein ARA-1
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 453
Score = 44.1 bits (22), Expect = 0.009
Identities = 32/34 (94%), Gaps = 1/34 (2%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaat-cctgcagcccgggggatc 867
||||| ||||||||| ||||||||||||||||||
Sbjct: 78 aacctcgtgccgaattcctgcagcccgggggatc 45
>gb|BE761834.1|BE761834 NXCI_070_D05_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_D05 5' similar to Arabidopsis
thaliana sequence At5g58420 ribosomal protein S4 - like
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 421
Score = 44.1 bits (22), Expect = 0.009
Identities = 32/34 (94%), Gaps = 1/34 (2%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaat-cctgcagcccgggggatc 867
||||| ||||||||| ||||||||||||||||||
Sbjct: 78 aacctcgtgccgaattcctgcagcccgggggatc 45
>gb|BG040234.1|BG040234 NXSI_110_A09_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_A09 5' similar to Arabidopsis thaliana
sequence At1g11360 unknown protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 477
Score = 44.1 bits (22), Expect = 0.009
Identities = 32/34 (94%), Gaps = 1/34 (2%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaat-cctgcagcccgggggatc 867
||||| ||||||||| ||||||||||||||||||
Sbjct: 75 aacctcgtgccgaattcctgcagcccgggggatc 42
>gb|BG040240.1|BG040240 NXSI_110_B01_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_B01 5' similar to Arabidopsis thaliana
sequence At1g13950 putative initiation factor 5A-4 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 623
Score = 44.1 bits (22), Expect = 0.009
Identities = 32/34 (94%), Gaps = 1/34 (2%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaat-cctgcagcccgggggatc 867
||||| ||||||||| ||||||||||||||||||
Sbjct: 75 aacctcgtgccgaattcctgcagcccgggggatc 42
>gb|BG040264.1|BG040264 NXSI_110_D02_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_D02 5' similar to Arabidopsis thaliana
sequence At2g07180 putative protein kinase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 621
Score = 44.1 bits (22), Expect = 0.009
Identities = 32/34 (94%), Gaps = 1/34 (2%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaat-cctgcagcccgggggatc 867
||||| ||||||||| ||||||||||||||||||
Sbjct: 76 aacctcgtgccgaattcctgcagcccgggggatc 43
>gb|BG040277.1|BG040277 NXSI_110_E06_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_E06 5' similar to Arabidopsis thaliana
sequence At2g43810 putative small nuclear
ribonucleoprotein polypeptide F see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 588
Score = 44.1 bits (22), Expect = 0.009
Identities = 32/34 (94%), Gaps = 1/34 (2%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaat-cctgcagcccgggggatc 867
||||| ||||||||| ||||||||||||||||||
Sbjct: 84 aacctcgtgccgaattcctgcagcccgggggatc 51
>gb|BG040290.1|BG040290 NXSI_110_F07_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_F07 5' similar to Arabidopsis thaliana
sequence At5g66910 disease resistance protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 586
Score = 44.1 bits (22), Expect = 0.009
Identities = 32/34 (94%), Gaps = 1/34 (2%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaat-cctgcagcccgggggatc 867
||||| ||||||||| ||||||||||||||||||
Sbjct: 78 aacctcgtgccgaattcctgcagcccgggggatc 45
>gb|BG040304.1|BG040304 NXSI_110_G10_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_G10 5' similar to Arabidopsis thaliana
sequence At4g38410 cold-regulated protein - like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 583
Score = 44.1 bits (22), Expect = 0.009
Identities = 32/34 (94%), Gaps = 1/34 (2%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaat-cctgcagcccgggggatc 867
||||| ||||||||| ||||||||||||||||||
Sbjct: 75 aacctcgtgccgaattcctgcagcccgggggatc 42
>gb|BQ696827.1|BQ696827 NXPV_045_G09_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_045_G09 5', mRNA sequence
Length = 271
Score = 44.1 bits (22), Expect = 0.009
Identities = 32/34 (94%), Gaps = 1/34 (2%)
Strand = Plus / Minus
Query: 835 aacctggtgccgaat-cctgcagcccgggggatc 867
||||| ||||||||| ||||||||||||||||||
Sbjct: 63 aacctcgtgccgaattcctgcagcccgggggatc 30
>gb|BE761866.1|BE761866 NXCI_070_G06_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_G06 5' similar to Arabidopsis
thaliana sequence At3g16640 translationally controlled
tumor protein-like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 339
Score = 42.1 bits (21), Expect = 0.037
Identities = 31/33 (93%), Gaps = 1/33 (3%)
Strand = Plus / Minus
Query: 836 acctggtgccgaat-cctgcagcccgggggatc 867
|||| ||||||||| ||||||||||||||||||
Sbjct: 80 acctcgtgccgaattcctgcagcccgggggatc 48
>gb|BG040235.1|BG040235 NXSI_110_A10_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_A10 5' similar to Arabidopsis thaliana
sequence At2g27710 60S acidic ribosomal protein P2 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 592
Score = 42.1 bits (21), Expect = 0.037
Identities = 31/33 (93%), Gaps = 1/33 (3%)
Strand = Plus / Minus
Query: 836 acctggtgccgaat-cctgcagcccgggggatc 867
|||| ||||||||| ||||||||||||||||||
Sbjct: 73 acctcgtgccgaattcctgcagcccgggggatc 41
>gb|BG040270.1|BG040270 NXSI_110_E02_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_E02 5' similar to Arabidopsis thaliana
sequence At4g01100 putative carrier protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 567
Score = 42.1 bits (21), Expect = 0.037
Identities = 31/33 (93%), Gaps = 1/33 (3%)
Strand = Plus / Minus
Query: 836 acctggtgccgaat-cctgcagcccgggggatc 867
|||| ||||||||| ||||||||||||||||||
Sbjct: 75 acctcgtgccgaattcctgcagcccgggggatc 43
>gb|BG040271.1|BG040271 NXSI_110_D10_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_D10 5' similar to Arabidopsis thaliana
sequence At4g38680 glycine-rich protein 2 (GRP2) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 414
Score = 42.1 bits (21), Expect = 0.037
Identities = 31/33 (93%), Gaps = 1/33 (3%)
Strand = Plus / Minus
Query: 836 acctggtgccgaat-cctgcagcccgggggatc 867
|||| ||||||||| ||||||||||||||||||
Sbjct: 75 acctcgtgccgaattcctgcagcccgggggatc 43
>gb|BG040303.1|BG040303 NXSI_110_G12_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_G12 5' similar to Arabidopsis thaliana
sequence At2g32060 40S ribosomal protein S12 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 528
Score = 42.1 bits (21), Expect = 0.037
Identities = 31/33 (93%), Gaps = 1/33 (3%)
Strand = Plus / Minus
Query: 836 acctggtgccgaat-cctgcagcccgggggatc 867
|||| ||||||||| ||||||||||||||||||
Sbjct: 75 acctcgtgccgaattcctgcagcccgggggatc 43
>gb|BG040309.1|BG040309 NXSI_110_H05_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_H05 5' similar to Arabidopsis thaliana
sequence At3g48425 putative protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 463
Score = 42.1 bits (21), Expect = 0.037
Identities = 31/33 (93%), Gaps = 1/33 (3%)
Strand = Plus / Minus
Query: 836 acctggtgccgaat-cctgcagcccgggggatc 867
|||| ||||||||| ||||||||||||||||||
Sbjct: 76 acctcgtgccgaattcctgcagcccgggggatc 44
>gb|BQ696835.1|BQ696835 NXPV_045_H12_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_045_H12 5', mRNA sequence
Length = 201
Score = 42.1 bits (21), Expect = 0.037
Identities = 31/33 (93%), Gaps = 1/33 (3%)
Strand = Plus / Minus
Query: 836 acctggtgccgaat-cctgcagcccgggggatc 867
|||| ||||||||| ||||||||||||||||||
Sbjct: 60 acctcgtgccgaattcctgcagcccgggggatc 28
>gb|BE761803.1|BE761803 NXCI_070_A04_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_A04 5', mRNA sequence
Length = 393
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 68 gtgccgaattcctgcagcccgggggatc 41
>gb|BE761804.1|BE761804 NXCI_070_A02_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_A02 5' similar to Arabidopsis
thaliana sequence At4g32551 Leunig protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 351
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 67 gtgccgaattcctgcagcccgggggatc 40
>gb|BE761805.1|BE761805 NXCI_070_A01_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_A01 5', mRNA sequence
Length = 223
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 58 gtgccgaattcctgcagcccgggggatc 31
>gb|BE761806.1|BE761806 NXCI_070_A06_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_A06 5' similar to Arabidopsis
thaliana sequence At1g13380 unknown protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 396
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 72 gtgccgaattcctgcagcccgggggatc 45
>gb|BE761807.1|BE761807 NXCI_070_A07_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_A07 5' similar to Arabidopsis
thaliana sequence At1g50010 tubulin alpha-2/alpha-4
chain, putative see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 447
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 71 gtgccgaattcctgcagcccgggggatc 44
>gb|BE761808.1|BE761808 NXCI_070_A08_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_A08 5' similar to Arabidopsis
thaliana sequence At4g13660 isoflavone reductase-like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 445
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 72 gtgccgaattcctgcagcccgggggatc 45
>gb|BE761809.1|BE761809 NXCI_070_A09_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_A09 5' similar to Arabidopsis
thaliana sequence At4g17510 carboxyl-terminal proteinase
like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 432
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 72 gtgccgaattcctgcagcccgggggatc 45
>gb|BE761810.1|BE761810 NXCI_070_A10_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_A10 5', mRNA sequence
Length = 255
Score = 40.1 bits (20), Expect = 0.15
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 848 atcctgcagcccgggggatc 867
||||||||||||||||||||
Sbjct: 64 atcctgcagcccgggggatc 45
>gb|BE761812.1|BE761812 NXCI_070_B01_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_B01 5', mRNA sequence
Length = 470
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 69 gtgccgaattcctgcagcccgggggatc 42
>gb|BE761813.1|BE761813 NXCI_070_B02_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_B02 5', mRNA sequence
Length = 479
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 67 gtgccgaattcctgcagcccgggggatc 40
>gb|BE761814.1|BE761814 NXCI_070_B03_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_B03 5' similar to Arabidopsis
thaliana sequence At4g13940 adenosylhomocysteinase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 532
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 68 gtgccgaattcctgcagcccgggggatc 41
>gb|BE761815.1|BE761815 NXCI_070_B04_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_B04 5' similar to Arabidopsis
thaliana sequence At1g79530 glyceraldehyde-3-phosphate
dehydrogenase (EC 1.2.1.12) precursor like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 480
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 75 gtgccgaattcctgcagcccgggggatc 48
>gb|BE761816.1|BE761816 NXCI_070_B05_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_B05 5', mRNA sequence
Length = 460
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 75 gtgccgaattcctgcagcccgggggatc 48
>gb|BE761817.1|BE761817 NXCI_070_B06_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_B06 5' similar to Arabidopsis
thaliana sequence At1g07890 L-ascorbate peroxidase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 415
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 72 gtgccgaattcctgcagcccgggggatc 45
>gb|BE761820.1|BE761820 NXCI_070_B10_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_B10 5', mRNA sequence
Length = 402
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 74 gtgccgaattcctgcagcccgggggatc 47
>gb|BE761821.1|BE761821 NXCI_070_B11_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_B11 5' similar to Arabidopsis
thaliana sequence At1g07310 unknown protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 326
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 68 gtgccgaattcctgcagcccgggggatc 41
>gb|BE761822.1|BE761822 NXCI_070_B12_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_B12 5' similar to Arabidopsis
thaliana sequence At3g59760 cysteine synthase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 375
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 71 gtgccgaattcctgcagcccgggggatc 44
>gb|BE761823.1|BE761823 NXCI_070_C01_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_C01 5' similar to Arabidopsis
thaliana sequence At3g44220 putative protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 508
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 72 gtgccgaattcctgcagcccgggggatc 45
>gb|BE761824.1|BE761824 NXCI_070_C02_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_C02 5' similar to Arabidopsis
thaliana sequence At3g10860 putative
ubiquinol-cytochrome C reductase complex
ubiquinone-binding protein (QP-C) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 538
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 72 gtgccgaattcctgcagcccgggggatc 45
>gb|BE761825.1|BE761825 NXCI_070_C03_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_C03 5' similar to Arabidopsis
thaliana sequence At4g13940 adenosylhomocysteinase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 499
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 68 gtgccgaattcctgcagcccgggggatc 41
>gb|BE761826.1|BE761826 NXCI_070_C05_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_C05 5' similar to Arabidopsis
thaliana sequence At3g23810 S-adenosyl-L-homocysteinas,
putative see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 519
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 69 gtgccgaattcctgcagcccgggggatc 42
>gb|BE761827.1|BE761827 NXCI_070_C04_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_C04 5' similar to Arabidopsis
thaliana sequence At5g65270 GTP-binding protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 442
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 68 gtgccgaattcctgcagcccgggggatc 41
>gb|BE761828.1|BE761828 NXCI_070_C06_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_C06 5' similar to Arabidopsis
thaliana sequence At4g34050 caffeoyl-CoA
O-methyltransferase - like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 533
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 68 gtgccgaattcctgcagcccgggggatc 41
>gb|BE761829.1|BE761829 NXCI_070_C07_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_C07 5', mRNA sequence
Length = 528
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 68 gtgccgaattcctgcagcccgggggatc 41
>gb|BE761830.1|BE761830 NXCI_070_D01_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_070_D01 5', mRNA sequence
Length = 439
Score = 40.1 bits (20), Expect = 0.15
Identities = 27/28 (96%), Gaps = 1/28 (3%)
Strand = Plus / Minus
Query: 841 gtgccgaat-cctgcagcccgggggatc 867
||||||||| ||||||||||||||||||
Sbjct: 68 gtgccgaattcctgcagcccgggggatc 41
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 103,877
Number of Sequences: 355925
Number of extensions: 103877
Number of successful extensions: 24619
Number of sequences better than 0.5: 172
Number of HSP's better than 0.5 without gapping: 16
Number of HSP's successfully gapped in prelim test: 156
Number of HSP's that attempted gapping in prelim test: 24588
Number of HSP's gapped (non-prelim): 187
length of query: 867
length of database: 217,277,237
effective HSP length: 19
effective length of query: 848
effective length of database: 210,514,662
effective search space: 178516433376
effective search space used: 178516433376
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)