BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2943819.2.1
(1121 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF387084.1|CF387084 RTDR1_10_E10.g1_A015 Loblolly pine r... 113 2e-023
gb|CF388213.1|CF388213 RTDR2_1_B07.g1_A021 Loblolly pine ro... 113 2e-023
gb|CX650454.1|CX650454 COLD1_45_F10.g1_A029 Root cold Pinus... 113 2e-023
gb|DR024153.1|DR024153 STRS1_62_E05.g1_A034 Shoot tip pitch... 113 2e-023
gb|DR111240.1|DR111240 RTS1_16_G05.b1_A029 Roots minus sulf... 113 2e-023
gb|DR060728.1|DR060728 RTNIT1_29_D06.g1_A029 Roots minus ni... 109 2e-022
gb|BF517838.1|BF517838 NXSI_027_G09_F NXSI (Nsf Xylem Side ... 105 4e-021
gb|BX681391.1|BX681391 BX681391 RS Pinus pinaster cDNA clon... 105 4e-021
gb|DR117421.1|DR117421 RTMG1_6_G12.g1_A029 Roots minus magn... 98 9e-019
gb|CF388652.1|CF388652 RTDR2_4_A10.g1_A021 Loblolly pine ro... 90 2e-016
gb|CF401736.1|CF401736 RTWW1_14_C05.g1_A015 Well-watered lo... 90 2e-016
gb|CV034082.1|CV034082 RTNACL1_38_B11.g1_A029 Roots plus ad... 90 2e-016
gb|DR111427.1|DR111427 RTS1_17_F02.g1_A029 Roots minus sulf... 90 2e-016
gb|DR168212.1|DR168212 RTPHOS1_23_H12.g1_A029 Roots minus p... 90 2e-016
gb|DR387764.1|DR387764 RTHG1_24_A11.b1_A029 Roots plus adde... 90 2e-016
gb|DR387774.1|DR387774 RTHG1_24_B11.b1_A029 Roots plus adde... 90 2e-016
gb|CF400460.1|CF400460 RTWW1_5_H12.g1_A015 Well-watered lob... 86 4e-015
gb|CF402623.1|CF402623 RTWW1_21_B11.g1_A015 Well-watered lo... 86 4e-015
gb|CX648418.1|CX648418 COLD1_28_B12.g1_A029 Root cold Pinus... 86 4e-015
gb|DR052727.1|DR052727 RTCA1_6_B03.g1_A029 Roots minus calc... 86 4e-015
gb|DR057958.1|DR057958 RTNIT1_8_G05.g1_A029 Roots minus nit... 86 4e-015
gb|DR117116.1|DR117116 RTMG1_4_G10.g1_A029 Roots minus magn... 86 4e-015
gb|DR161238.1|DR161238 RTFE1_10_D10.g1_A029 Roots minus iro... 86 4e-015
gb|BX679906.1|BX679906 BX679906 RS Pinus pinaster cDNA clon... 82 6e-014
gb|DR164052.1|DR164052 RTFE1_46_B11.g1_A029 Roots minus iro... 82 6e-014
gb|DR178268.1|DR178268 RTMNUT1_10_C01.g1_A029 Roots minus m... 82 6e-014
gb|CF385274.1|CF385274 RTDR1_2_D01.g1_A015 Loblolly pine ro... 78 9e-013
gb|CF389081.1|CF389081 RTDR2_13_A10.g1_A021 Loblolly pine r... 78 9e-013
gb|CN852309.1|CN852309 Pi148-1 Salicylate-treated slash pin... 78 9e-013
gb|CO162411.1|CO162411 FLD1_35_D02.b1_A029 Root flooded Pin... 78 9e-013
gb|CX646616.1|CX646616 COLD1_10_A05.g1_A029 Root cold Pinus... 78 9e-013
gb|CF393923.1|CF393923 RTDS2_2_G07.b1_A021 Drought-stressed... 74 1e-011
gb|CO162486.1|CO162486 FLD1_35_D02.g1_A029 Root flooded Pin... 74 1e-011
gb|CO198121.1|CO198121 GEO1_11_A02.g1_A029 Root gravitropis... 74 1e-011
gb|CO361315.1|CO361315 NDL2_4_D03.b1_A029 Needles control 2... 74 1e-011
gb|CO361397.1|CO361397 NDL2_4_D03.g1_A029 Needles control 2... 74 1e-011
gb|CO367346.1|CO367346 RTK1_33_F05.g1_A029 Roots minus pota... 74 1e-011
gb|CV034016.1|CV034016 RTNACL1_38_B11.b1_A029 Roots plus ad... 74 1e-011
gb|CX646534.1|CX646534 COLD1_10_A05.b1_A029 Root cold Pinus... 74 1e-011
gb|CX648339.1|CX648339 COLD1_28_B12.b1_A029 Root cold Pinus... 74 1e-011
gb|DR057870.1|DR057870 RTNIT1_8_G05.b1_A029 Roots minus nit... 74 1e-011
gb|DR179654.1|DR179654 RTMNUT1_23_B05.g2_A029 Roots minus m... 74 1e-011
gb|CF401126.1|CF401126 RTWW1_10_H02.b1_A015 Well-watered lo... 70 2e-010
gb|BX680288.1|BX680288 BX680288 RS Pinus pinaster cDNA clon... 70 2e-010
gb|BQ701670.1|BQ701670 NXSI_118_C02_F NXSI (Nsf Xylem Side ... 68 8e-010
gb|CF667045.1|CF667045 RTCNT1_27_G11.g1_A029 Root control P... 68 8e-010
gb|CO362724.1|CO362724 RTK1_5_A02.g1_A029 Roots minus potas... 68 8e-010
gb|DR014691.1|DR014691 HEAT1_51_B07.b1_A029 Root at 37 C fo... 68 8e-010
gb|DR014768.1|DR014768 HEAT1_51_B07.g1_A029 Root at 37 C fo... 68 8e-010
gb|DR177927.1|DR177927 RTMNUT1_8_E11.b1_A029 Roots minus mi... 68 8e-010
gb|DR161095.1|DR161095 RTFE1_9_G03.g1_A029 Roots minus iron... 66 3e-009
gb|CO200901.1|CO200901 RTCNT2_2_G06.b1_A029 Root control 2 ... 64 1e-008
gb|DR020641.1|DR020641 STRS1_38_G12.b1_A034 Shoot tip pitch... 64 1e-008
gb|DR020720.1|DR020720 STRS1_38_G12.g1_A034 Shoot tip pitch... 64 1e-008
gb|DR167833.1|DR167833 RTPHOS1_21_A06.g1_A029 Roots minus p... 64 1e-008
gb|BX250447.1|BX250447 BX250447 Pinus pinaster differenciat... 62 5e-008
gb|CF387233.1|CF387233 RTDR1_11_B07.g1_A015 Loblolly pine r... 62 5e-008
gb|CO164694.1|CO164694 FLD1_49_E04.g1_A029 Root flooded Pin... 62 5e-008
gb|CO201585.1|CO201585 RTCNT2_6_F07.g1_A029 Root control 2 ... 60 2e-007
gb|DR017577.1|DR017577 STRS1_17_E03.b1_A034 Shoot tip pitch... 60 2e-007
gb|DR017658.1|DR017658 STRS1_17_E03.g1_A034 Shoot tip pitch... 60 2e-007
gb|DR117678.1|DR117678 RTMG1_8_A10.g1_A029 Roots minus magn... 60 2e-007
gb|DR117679.1|DR117679 RTMG1_8_A11.g1_A029 Roots minus magn... 60 2e-007
gb|DR163874.1|DR163874 RTFE1_45_A12.g1_A029 Roots minus iro... 60 2e-007
gb|DR101912.1|DR101912 STRR1_76_E01.g1_A033 Stem Response R... 58 8e-007
gb|AW065119.1|AW065119 ST39H05 Pine TriplEx shoot tip libra... 54 1e-005
gb|CO170303.1|CO170303 NDL1_13_D05.b1_A029 Needles control ... 54 1e-005
gb|CO361388.1|CO361388 NDL2_4_C06.g1_A029 Needles control 2... 54 1e-005
gb|DR058733.1|DR058733 RTNIT1_13_C07.g1_A029 Roots minus ni... 54 1e-005
gb|DR098778.1|DR098778 STRR1_47_G01.g1_A033 Stem Response R... 54 1e-005
gb|CF386859.1|CF386859 RTDR1_9_D11.b1_A015 Loblolly pine ro... 52 5e-005
gb|CF391376.1|CF391376 RTDR3_1_G04.g1_A022 Loblolly pine ro... 52 5e-005
gb|CF395899.1|CF395899 RTDS2_19_G06.g1_A021 Drought-stresse... 52 5e-005
gb|CF478238.1|CF478238 RTWW3_19_H07.g1_A022 Well-watered lo... 52 5e-005
gb|CO176256.1|CO176256 NDL1_60_G12.g1_A029 Needles control ... 52 5e-005
gb|CF668816.1|CF668816 RTCNT1_38_G11.g1_A029 Root control P... 50 2e-004
gb|CO173370.1|CO173370 NDL1_35_F03.g1_A029 Needles control ... 50 2e-004
gb|CO361678.1|CO361678 NDL2_6_H01.b1_A029 Needles control 2... 50 2e-004
gb|CO361758.1|CO361758 NDL2_6_H01.g1_A029 Needles control 2... 50 2e-004
gb|DR101544.1|DR101544 STRR1_74_C02.b1_A033 Stem Response R... 50 2e-004
gb|DR101609.1|DR101609 STRR1_74_C02.g1_A033 Stem Response R... 50 2e-004
gb|DR111301.1|DR111301 RTS1_16_F03.g1_A029 Roots minus sulf... 50 2e-004
gb|DR694940.1|DR694940 EST1085033 Normalized pine embryo li... 50 2e-004
gb|DT639133.1|DT639133 EST1154064 Normalized pine embryo li... 50 2e-004
gb|CF391408.1|CF391408 RTDR3_1_E10.g1_A022 Loblolly pine ro... 48 8e-004
gb|CF394327.1|CF394327 RTDS2_4_B08.g1_A021 Drought-stressed... 48 8e-004
gb|CF395727.1|CF395727 RTDS2_16_B07.g1_A021 Drought-stresse... 48 8e-004
gb|CF397272.1|CF397272 RTDS3_2_C01.g1_A022 Drought-stressed... 48 8e-004
gb|CF474496.1|CF474496 RTWW2_9_D02.b1_A021 Well-watered lob... 48 8e-004
gb|CF665728.1|CF665728 RTCNT1_18_C05.b1_A029 Root control P... 48 8e-004
gb|CF669490.1|CF669490 RTCNT1_44_A10.b1_A029 Root control P... 48 8e-004
gb|CO163969.1|CO163969 FLD1_45_A11.b1_A029 Root flooded Pin... 48 8e-004
gb|CO368639.1|CO368639 RTK1_41_H02.g1_A029 Roots minus pota... 48 8e-004
gb|CX647457.1|CX647457 COLD1_16_B04.g1_A029 Root cold Pinus... 48 8e-004
gb|DR023047.1|DR023047 STRS1_55_D09.b1_A034 Shoot tip pitch... 48 8e-004
gb|DR079868.1|DR079868 RTFEPL1_18_F11.b1_A029 Roots plus ad... 48 8e-004
gb|DR079932.1|DR079932 RTFEPL1_18_F11.g1_A029 Roots plus ad... 48 8e-004
gb|DR117333.1|DR117333 RTMG1_6_G12.b1_A029 Roots minus magn... 48 8e-004
gb|DR686108.1|DR686108 EST1076186 Normalized pine embryo li... 48 8e-004
gb|DR744906.1|DR744906 RTCU1_25_E06.g1_A029 Roots plus adde... 48 8e-004
gb|DT633531.1|DT633531 EST1148462 Normalized pine embryo li... 48 8e-004
gb|CF390133.1|CF390133 RTDR2_12_C07.g1_A021 Loblolly pine r... 46 0.003
gb|CF393225.1|CF393225 RTDR3_17_D12.g1_A022 Loblolly pine r... 46 0.003
gb|CF396127.1|CF396127 RTDS2_13_D06.g1_A021 Drought-stresse... 46 0.003
gb|CF472757.1|CF472757 RTDS1_11_D09.g1_A015 Drought-stresse... 46 0.003
gb|CO172303.1|CO172303 NDL1_28_G10.g1_A029 Needles control ... 46 0.003
gb|CO365658.1|CO365658 RTK1_18_A01.g1_A029 Roots minus pota... 46 0.003
gb|CO367106.1|CO367106 RTK1_32_E03.b1_A029 Roots minus pota... 46 0.003
gb|CO367178.1|CO367178 RTK1_32_E03.g1_A029 Roots minus pota... 46 0.003
gb|DR011035.1|DR011035 HEAT1_3_A03.b1_A029 Root at 37 C for... 46 0.003
gb|DR014845.1|DR014845 HEAT1_52_A11.b1_A029 Root at 37 C fo... 46 0.003
gb|DR014928.1|DR014928 HEAT1_52_A11.g1_A029 Root at 37 C fo... 46 0.003
gb|DR015213.1|DR015213 STRS1_2_D10.b1_A034 Shoot tip pitch ... 46 0.003
gb|DR015297.1|DR015297 STRS1_2_D10.g1_A034 Shoot tip pitch ... 46 0.003
gb|DR023090.1|DR023090 STRS1_55_A05.g1_A034 Shoot tip pitch... 46 0.003
gb|DR059765.1|DR059765 RTNIT1_19_D08.g1_A029 Roots minus ni... 46 0.003
gb|DR071883.1|DR071883 RTDK1_22_E02.g1_A029 Roots, dark Pin... 46 0.003
gb|DR099264.1|DR099264 STRR1_54_G08.b1_A033 Stem Response R... 46 0.003
gb|DR099337.1|DR099337 STRR1_54_G08.g1_A033 Stem Response R... 46 0.003
gb|DR111182.1|DR111182 RTS1_16_A02.b1_A029 Roots minus sulf... 46 0.003
gb|DR161362.1|DR161362 RTFE1_11_H03.b1_A029 Roots minus iro... 46 0.003
gb|DR161451.1|DR161451 RTFE1_11_H03.g1_A029 Roots minus iro... 46 0.003
gb|DR694707.1|DR694707 EST1084799 Normalized pine embryo li... 46 0.003
gb|DT638995.1|DT638995 EST1153926 Normalized pine embryo li... 46 0.003
gb|AY356372.1| Pinus taeda R2R3-MYB transcription factor (M... 46 0.003
gb|AW065064.1|AW065064 ST39B10 Pine TriplEx shoot tip libra... 44 0.012
gb|BE241255.1|BE241255 NXNV_183_D12_F Nsf Xylem Normal wood... 44 0.012
gb|CD020726.1|CD020726 NXNV_088_G08_F Nsf Xylem Normal wood... 44 0.012
gb|BX784172.1|BX784172 BX784172 Pinus pinaster differenciat... 44 0.012
gb|DR109956.1|DR109956 RTS1_1_B02.b1_A029 Roots minus sulfu... 44 0.012
gb|AY356371.1| Pinus taeda R2R3-MYB transcription factor (M... 44 0.012
gb|CF395399.1|CF395399 RTDS2_11_H08.g1_A021 Drought-stresse... 42 0.048
gb|CF396247.1|CF396247 RTDS2_15_B11.g1_A021 Drought-stresse... 42 0.048
gb|CF667292.1|CF667292 RTCNT1_29_G02.b1_A029 Root control P... 42 0.048
gb|CO175228.1|CO175228 NDL1_53_H05.b1_A029 Needles control ... 42 0.048
gb|CO361899.1|CO361899 NDL2_7_G04.g1_A029 Needles control 2... 42 0.048
gb|CX646566.1|CX646566 COLD1_10_D06.b1_A029 Root cold Pinus... 42 0.048
gb|DR051127.1|DR051127 RTBOR1_27_G08.g1_A029 Roots plus add... 42 0.048
gb|DR059561.1|DR059561 RTNIT1_18_A02.g1_A029 Roots minus ni... 42 0.048
gb|DR081462.1|DR081462 RTFEPL1_29_G04.g1_A029 Roots plus ad... 42 0.048
gb|DR167401.1|DR167401 RTPHOS1_18_C09.g1_A029 Roots minus p... 42 0.048
gb|DR744198.1|DR744198 RTCU1_20_G08.g1_A029 Roots plus adde... 42 0.048
gb|BE520012.1|BE520012 NXCI_028_B03_F NXCI (Nsf Xylem Compr... 40 0.19
gb|BQ290999.1|BQ290999 NXRV054_D07_F NXRV (Nsf Xylem Root w... 40 0.19
gb|BQ634727.1|BQ634727 NXRV072_E09_F NXRV (Nsf Xylem Root w... 40 0.19
gb|CD025338.1|CD025338 NXSI_044_F04_F NXSI (Nsf Xylem Side ... 40 0.19
gb|CF392063.1|CF392063 RTDR3_12_C02.g1_A022 Loblolly pine r... 40 0.19
gb|CF399612.1|CF399612 RTDS3_26_H01.g1_A022 Drought-stresse... 40 0.19
gb|CF663690.1|CF663690 RTCNT1_4_C02.g1_A029 Root control Pi... 40 0.19
gb|CO173202.1|CO173202 NDL1_34_E01.g1_A029 Needles control ... 40 0.19
gb|CV034623.1|CV034623 RTNACL1_10_A11.g1_A029 Roots plus ad... 40 0.19
gb|DR050898.1|DR050898 RTBOR1_26_H05.b1_A029 Roots plus add... 40 0.19
>gb|CF387084.1|CF387084 RTDR1_10_E10.g1_A015 Loblolly pine roots recovering from drought DR1
Pinus taeda cDNA clone RTDR1_10_E10_A015 5', mRNA
sequence
Length = 733
Score = 113 bits (57), Expect = 2e-023
Identities = 225/281 (80%)
Strand = Plus / Minus
Query: 798 ttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgac 857
|||||||||||||| |||||||||||||||||||| || | | | || || || |||
Sbjct: 337 ttccagtagttctttatctcgttgtccgtccgcccgggcaatctgcctgcaataagagac 278
Query: 858 cacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaag 917
|||||||| ||||| ||| ||| || |||| |||||| ||||| || || | | ||||
Sbjct: 277 cacttgttgccgagcagggagtggagtttgatgatgagttcgtcttcttcttctgagaag 218
Query: 918 ttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccg 977
|| || |||||||| || || || |||||||| ||||| || |||| ||||||||| |||
Sbjct: 217 tttccacgcttcagatcaggacgcaggtagtttatccatcggagcctgcagctcttcccg 158
Query: 978 caccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgg 1037
|| |||| ||| || || |||||||| ||||| |||||||| ||||||||||| | ||
Sbjct: 157 cagcgcatcagccctgcggccttgggaagcgagcgccagcaaccttcgccgtgagttcga 98
Query: 1038 atgtaggccaccaggcgctcgtcctcctccttggtccacgc 1078
|||| ||| | ||||| |||||||| || |||||||||||
Sbjct: 97 atgtgggcgatgaggcgatcgtcctcttctttggtccacgc 57
>gb|CF388213.1|CF388213 RTDR2_1_B07.g1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_1_B07_A021 5', mRNA sequence
Length = 712
Score = 113 bits (57), Expect = 2e-023
Identities = 225/281 (80%)
Strand = Plus / Minus
Query: 798 ttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgac 857
|||||||||||||| |||||||||||||||||||| || | | | || || || |||
Sbjct: 379 ttccagtagttctttatctcgttgtccgtccgcccgggcaatctgcctgcaataagagac 320
Query: 858 cacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaag 917
|||||||| ||||| ||| ||| || |||| |||||| ||||| || || | | ||||
Sbjct: 319 cacttgttgccgagcagggagtggagtttgatgatgagttcgtcttcttcttctgagaag 260
Query: 918 ttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccg 977
|| || |||||||| || || || |||||||| ||||| || |||| ||||||||| |||
Sbjct: 259 tttccacgcttcagatcaggacgcaggtagtttatccatcggagcctgcagctcttcccg 200
Query: 978 caccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgg 1037
|| |||| ||| || || |||||||| ||||| |||||||| ||||||||||| | ||
Sbjct: 199 cagcgcatcagccctgcggccttgggaagcgagcgccagcaaccttcgccgtgagttcga 140
Query: 1038 atgtaggccaccaggcgctcgtcctcctccttggtccacgc 1078
|||| ||| | ||||| |||||||| || |||||||||||
Sbjct: 139 atgtgggcgatgaggcgatcgtcctcttctttggtccacgc 99
>gb|CX650454.1|CX650454 COLD1_45_F10.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_45_F10_A029 5', mRNA sequence
Length = 826
Score = 113 bits (57), Expect = 2e-023
Identities = 225/281 (80%)
Strand = Plus / Minus
Query: 798 ttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgac 857
|||||||||||||| |||||||||||||||||||| || | | | || || || |||
Sbjct: 368 ttccagtagttctttatctcgttgtccgtccgcccgggcaatctgcctgcaataagagac 309
Query: 858 cacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaag 917
|||||||| ||||| ||| ||| || |||| |||||| ||||| || || | | ||||
Sbjct: 308 cacttgttgccgagcagggagtggagtttgatgatgagttcgtcttcttcttctgagaag 249
Query: 918 ttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccg 977
|| || |||||||| || || || |||||||| ||||| || |||| ||||||||| |||
Sbjct: 248 tttccacgcttcagatcaggacgcaggtagtttatccatcggagcctgcagctcttcccg 189
Query: 978 caccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgg 1037
|| |||| ||| || || |||||||| ||||| |||||||| ||||||||||| | ||
Sbjct: 188 cagcgcatcagccctgcggccttgggaagcgagcgccagcaaccttcgccgtgagttcga 129
Query: 1038 atgtaggccaccaggcgctcgtcctcctccttggtccacgc 1078
|||| ||| | ||||| |||||||| || |||||||||||
Sbjct: 128 atgtgggcgatgaggcgatcgtcctcttctttggtccacgc 88
>gb|DR024153.1|DR024153 STRS1_62_E05.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_62_E05_A034 5', mRNA sequence
Length = 791
Score = 113 bits (57), Expect = 2e-023
Identities = 225/281 (80%)
Strand = Plus / Minus
Query: 798 ttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgac 857
|||||||||||||| |||||||||||||||||||| || | | | || || || |||
Sbjct: 363 ttccagtagttctttatctcgttgtccgtccgcccgggcaatctgcctgcaataagagac 304
Query: 858 cacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaag 917
|||||||| ||||| ||| ||| || |||| |||||| ||||| || || | | ||||
Sbjct: 303 cacttgttgccgagcagggagtggagtttgatgatgagttcgtcttcttcttctgagaag 244
Query: 918 ttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccg 977
|| || |||||||| || || || |||||||| ||||| || |||| ||||||||| |||
Sbjct: 243 tttccacgcttcagatcaggacgcaggtagtttatccatcggagcctgcagctcttcccg 184
Query: 978 caccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgg 1037
|| |||| ||| || || |||||||| ||||| |||||||| ||||||||||| | ||
Sbjct: 183 cagcgcatcagccctgcggccttgggaagcgagcgccagcaaccttcgccgtgagttcga 124
Query: 1038 atgtaggccaccaggcgctcgtcctcctccttggtccacgc 1078
|||| ||| | ||||| |||||||| || |||||||||||
Sbjct: 123 atgtgggcgatgaggcgatcgtcctcttctttggtccacgc 83
>gb|DR111240.1|DR111240 RTS1_16_G05.b1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_16_G05_A029 3', mRNA sequence
Length = 625
Score = 113 bits (57), Expect = 2e-023
Identities = 225/281 (80%)
Strand = Plus / Plus
Query: 798 ttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgac 857
|||||||||||||| |||||||||||||||||||| || | | | || || || |||
Sbjct: 313 ttccagtagttctttatctcgttgtccgtccgcccgggcaatctgcctgcaataagagac 372
Query: 858 cacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaag 917
|||||||| ||||| ||| ||| || |||| |||||| ||||| || || | | ||||
Sbjct: 373 cacttgttgccgagcagggagtggagtttgatgatgagttcgtcttcttcttctgagaag 432
Query: 918 ttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccg 977
|| || |||||||| || || || |||||||| ||||| || |||| ||||||||| |||
Sbjct: 433 tttccacgcttcagatcaggacgcaggtagtttatccatcggagcctgcagctcttcccg 492
Query: 978 caccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgg 1037
|| |||| ||| || || |||||||| ||||| |||||||| ||||||||||| | ||
Sbjct: 493 cagcgcatcagccctgcggccttgggaagcgagcgccagcaaccttcgccgtgagttcga 552
Query: 1038 atgtaggccaccaggcgctcgtcctcctccttggtccacgc 1078
|||| ||| | ||||| |||||||| || |||||||||||
Sbjct: 553 atgtgggcgatgaggcgatcgtcctcttctttggtccacgc 593
>gb|DR060728.1|DR060728 RTNIT1_29_D06.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_29_D06_A029 5', mRNA sequence
Length = 726
Score = 109 bits (55), Expect = 2e-022
Identities = 223/279 (79%)
Strand = Plus / Minus
Query: 798 ttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgac 857
|||||||||||||| |||||||||||||||||||| || | | | || || || |||
Sbjct: 351 ttccagtagttctttatctcgttgtccgtccgcccgggcaatctgcctgcaataagagac 292
Query: 858 cacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaag 917
|||||||| ||||| ||| ||| || |||| |||||| ||||| || || | | ||||
Sbjct: 291 cacttgttgccgagcagggagtggagtttgatgatgagttcgtcttcttcttctgagaag 232
Query: 918 ttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccg 977
|| || |||||||| || || || |||||||| ||||| || |||| ||||||||| |||
Sbjct: 231 tttccacgcttcagatcaggacgcaggtagtttatccatcggagcctgcagctcttcccg 172
Query: 978 caccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgg 1037
|| |||| ||| || || |||||||| ||||| |||||||| ||||||||||| | ||
Sbjct: 171 cagcgcatcagccctgcggccttgggaagcgagcgccagcaaccttcgccgtgagttcga 112
Query: 1038 atgtaggccaccaggcgctcgtcctcctccttggtccac 1076
|||| ||| | ||||| |||||||| || |||||||||
Sbjct: 111 atgtgggcgatgaggcgatcgtcctcttctttggtccac 73
>gb|BF517838.1|BF517838 NXSI_027_G09_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_027_G09 5' similar to Arabidopsis thaliana
sequence At4g38620 putative transcription factor (MYB4)
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 494
Score = 105 bits (53), Expect = 4e-021
Identities = 223/281 (79%)
Strand = Plus / Minus
Query: 798 ttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgac 857
|||||||||||||| |||||||||||||||||||| || | | || || || |||
Sbjct: 418 ttccagtagttctttatctcgttgtccgtccgcccgggcaatcngnntgcaataagagac 359
Query: 858 cacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaag 917
|||||||| ||||| ||| ||| || |||| |||||| ||||| || || | | | ||
Sbjct: 358 cacttgttgccgagcagggagtggagtttgatgatgagttcgtcttcttcttctgagnag 299
Query: 918 ttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccg 977
|| || |||||||| || || || |||||||| ||||| || |||| ||||||||| |||
Sbjct: 298 tttccacgcttcagatcaggacgcaggtagtttatccatcggagcctgcagctcttcccg 239
Query: 978 caccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcgcgg 1037
|| |||| ||| || || |||||||| ||||| |||||||| ||||||||||| | ||
Sbjct: 238 cagcgcatcagccctgcggccttgggaagcgagcgccagcaaccttcgccgtgagttcga 179
Query: 1038 atgtaggccaccaggcgctcgtcctcctccttggtccacgc 1078
|||| ||| | ||||| |||||||| || |||||||||||
Sbjct: 178 atgtgggcgatgaggcgatcgtcctcttctttggtccacgc 138
>gb|BX681391.1|BX681391 BX681391 RS Pinus pinaster cDNA clone RS58C06, mRNA sequence
Length = 605
Score = 105 bits (53), Expect = 4e-021
Identities = 188/233 (80%)
Strand = Plus / Minus
Query: 798 ttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgac 857
|||||||||||||| |||||||||||||||||||| || | | | || || || |||
Sbjct: 325 ttccagtagttctttatctcgttgtccgtccgcccgggcaatctgcctgcaataagagac 266
Query: 858 cacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaag 917
|||||||| ||||| ||| ||| || |||| |||||| ||||| || || | | ||||
Sbjct: 265 cacttgttgccgagtagggagtggagtttgatgatgagttcgtcttcttcttctgagaag 206
Query: 918 ttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccg 977
|| || |||||||| || || || |||||||| ||||| || |||| ||||||||| |||
Sbjct: 205 tttccacgcttcagatcaggacgcaggtagtttatccatcggagcctgcagctcttcccg 146
Query: 978 caccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030
|| |||| ||| || || |||||||| ||||| |||||||| |||||||||||
Sbjct: 145 cagcgcatcagccctgcggccttgggaagcgagcgccagcaaccttcgccgtg 93
>gb|DR117421.1|DR117421 RTMG1_6_G12.g1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_6_G12_A029 5', mRNA sequence
Length = 872
Score = 97.6 bits (49), Expect = 9e-019
Identities = 187/233 (80%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| |||||||||||||| ||||| || | | | | || || ||
Sbjct: 233 gtgttccagtagttctttatctcgttgtccgtgcgcccgggcaatctccctgcaataaga 174
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| ||||| ||| ||| || |||| |||||| ||||| || || | | |
Sbjct: 173 gaccacttgttgccgagaagggagtggagtttgatgatgagctcgtcttcttcttcagag 114
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||||| || |||||||| ||||| || | |||||| ||||| || |||| |||||||||
Sbjct: 113 aagtttccacgcttcagatcgggacgcaagtagtttatccatcggagcctgcagctcttc 54
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgcc 1027
||||| |||| ||| || || |||||||| ||||| ||||||| ||||||||
Sbjct: 53 ccgcatcgcatcagccctgcggccttgggaagcgaacgccagccgccttcgcc 1
>gb|CF388652.1|CF388652 RTDR2_4_A10.g1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_4_A10_A021 5', mRNA sequence
Length = 760
Score = 89.7 bits (45), Expect = 2e-016
Identities = 249/317 (78%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 353 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 294
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 293 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 234
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 233 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 174
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcg 1034
||||| | | |||| || || |||||||| || || ||||||| |||||||||| ||
Sbjct: 173 ccgcatctcggcagccctgcagccttgggaagggaacgccagctgccttcgccgttggct 114
Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgc 1094
|| ||||| || | ||||| | ||| || || || ||||| || || ||||||| ||
Sbjct: 113 cgaatgtaagcaatgaggcggtggtcttcttcttttgtccaggcccctttgttggtatga 54
Query: 1095 gccttctcgcagcaggg 1111
|||||||||||||||||
Sbjct: 53 gccttctcgcagcaggg 37
>gb|CF401736.1|CF401736 RTWW1_14_C05.g1_A015 Well-watered loblolly pine roots WW1 Pinus taeda
cDNA clone RTWW1_14_C05_A015 5', mRNA sequence
Length = 792
Score = 89.7 bits (45), Expect = 2e-016
Identities = 249/317 (78%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 322 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 263
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 262 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 203
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 202 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 143
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcg 1034
||||| | | |||| || || |||||||| || || ||||||| |||||||||| ||
Sbjct: 142 ccgcatctcggcagccctgcagccttgggaagggaacgccagctgccttcgccgttggct 83
Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgc 1094
|| ||||| || | ||||| | ||| || || || ||||| || || ||||||| ||
Sbjct: 82 cgaatgtaagcaatgaggcggtggtcttcttcttttgtccaggcccctttgttggtatga 23
Query: 1095 gccttctcgcagcaggg 1111
|||||||||||||||||
Sbjct: 22 gccttctcgcagcaggg 6
>gb|CV034082.1|CV034082 RTNACL1_38_B11.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_38_B11_A029 5', mRNA sequence
Length = 734
Score = 89.7 bits (45), Expect = 2e-016
Identities = 249/317 (78%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 330 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 271
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 270 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 211
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 210 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 151
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcg 1034
||||| | | |||| || || |||||||| || || ||||||| |||||||||| ||
Sbjct: 150 ccgcatctcggcagccctgcagccttgggaagggaacgccagctgccttcgccgttggct 91
Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgc 1094
|| ||||| || | ||||| | ||| || || || ||||| || || ||||||| ||
Sbjct: 90 cgaatgtaagcaatgaggcggtggtcttcttcttttgtccaggcccctttgttggtatga 31
Query: 1095 gccttctcgcagcaggg 1111
|||||||||||||||||
Sbjct: 30 gccttctcgcagcaggg 14
>gb|DR111427.1|DR111427 RTS1_17_F02.g1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_17_F02_A029 5', mRNA sequence
Length = 630
Score = 89.7 bits (45), Expect = 2e-016
Identities = 249/317 (78%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 339 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 280
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 279 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 220
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 219 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 160
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcg 1034
||||| | | |||| || || |||||||| || || ||||||| |||||||||| ||
Sbjct: 159 ccgcatctcggcagccctgcagccttgggaagggaacgccagctgccttcgccgttggct 100
Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgc 1094
|| ||||| || | ||||| | ||| || || || ||||| || || ||||||| ||
Sbjct: 99 cgaatgtaagcaatgaggcggtggtcttcttcttttgtccaggcccctttgttggtatga 40
Query: 1095 gccttctcgcagcaggg 1111
|||||||||||||||||
Sbjct: 39 gccttctcgcagcaggg 23
>gb|DR168212.1|DR168212 RTPHOS1_23_H12.g1_A029 Roots minus phosphorous Pinus taeda cDNA clone
RTPHOS1_23_H12_A029 5', mRNA sequence
Length = 600
Score = 89.7 bits (45), Expect = 2e-016
Identities = 249/317 (78%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 331 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 272
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 271 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 212
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 211 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 152
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcg 1034
||||| | | |||| || || |||||||| || || ||||||| |||||||||| ||
Sbjct: 151 ccgcatctcggcagccctgcagccttgggaagggaacgccagctgccttcgccgttggct 92
Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgc 1094
|| ||||| || | ||||| | ||| || || || ||||| || || ||||||| ||
Sbjct: 91 cgaatgtaagcaatgaggcggtggtcttcttcttttgtccaggcccctttgttggtatga 32
Query: 1095 gccttctcgcagcaggg 1111
|||||||||||||||||
Sbjct: 31 gccttctcgcagcaggg 15
>gb|DR387764.1|DR387764 RTHG1_24_A11.b1_A029 Roots plus added mercury Pinus taeda cDNA clone
RTHG1_24_A11_A029 3', mRNA sequence
Length = 796
Score = 89.7 bits (45), Expect = 2e-016
Identities = 249/317 (78%)
Strand = Plus / Plus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 463 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 522
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 523 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 582
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 583 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 642
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcg 1034
||||| | | |||| || || |||||||| || || ||||||| |||||||||| ||
Sbjct: 643 ccgcatctcggcagccctgcagccttgggaagggaacgccagctgccttcgccgttggct 702
Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgc 1094
|| ||||| || | ||||| | ||| || || || ||||| || || ||||||| ||
Sbjct: 703 cgaatgtaagcaatgaggcggtggtcttcttcttttgtccaggcccctttgttggtatga 762
Query: 1095 gccttctcgcagcaggg 1111
|||||||||||||||||
Sbjct: 763 gccttctcgcagcaggg 779
>gb|DR387774.1|DR387774 RTHG1_24_B11.b1_A029 Roots plus added mercury Pinus taeda cDNA clone
RTHG1_24_B11_A029 3', mRNA sequence
Length = 781
Score = 89.7 bits (45), Expect = 2e-016
Identities = 249/317 (78%)
Strand = Plus / Plus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 439 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 498
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 499 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 558
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 559 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 618
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcg 1034
||||| | | |||| || || |||||||| || || ||||||| |||||||||| ||
Sbjct: 619 ccgcatctcggcagccctgcagccttgggaagggaacgccagctgccttcgccgttggct 678
Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgc 1094
|| ||||| || | ||||| | ||| || || || ||||| || || ||||||| ||
Sbjct: 679 cgaatgtaagcaatgaggcggtggtcttcttcttttgtccaggcccctttgttggtatga 738
Query: 1095 gccttctcgcagcaggg 1111
|||||||||||||||||
Sbjct: 739 gccttctcgcagcaggg 755
>gb|CF400460.1|CF400460 RTWW1_5_H12.g1_A015 Well-watered loblolly pine roots WW1 Pinus taeda
cDNA clone RTWW1_5_H12_A015 5', mRNA sequence
Length = 747
Score = 85.7 bits (43), Expect = 4e-015
Identities = 187/235 (79%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 287 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 228
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 227 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 168
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 167 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 108
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgt 1029
||||| | | |||| || || |||||||| || || ||||||| ||||||||||
Sbjct: 107 ccgcatctcggcagccctgcagccttgggaagggaacgccagctgccttcgccgt 53
>gb|CF402623.1|CF402623 RTWW1_21_B11.g1_A015 Well-watered loblolly pine roots WW1 Pinus taeda
cDNA clone RTWW1_21_B11_A015 5', mRNA sequence
Length = 755
Score = 85.7 bits (43), Expect = 4e-015
Identities = 187/235 (79%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 299 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 240
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 239 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 180
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 179 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 120
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgt 1029
||||| | | |||| || || |||||||| || || ||||||| ||||||||||
Sbjct: 119 ccgcatctcggcagccctgcagccttgggaagggaacgccagctgccttcgccgt 65
>gb|CX648418.1|CX648418 COLD1_28_B12.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_28_B12_A029 5', mRNA sequence
Length = 868
Score = 85.7 bits (43), Expect = 4e-015
Identities = 187/235 (79%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 334 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 275
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 274 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 215
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 214 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 155
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgt 1029
||||| | | |||| || || |||||||| || || ||||||| ||||||||||
Sbjct: 154 ccgcatctcggcagccctgcagccttgggaagggaacgccagctgccttcgccgt 100
>gb|DR052727.1|DR052727 RTCA1_6_B03.g1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_6_B03_A029 5', mRNA sequence
Length = 801
Score = 85.7 bits (43), Expect = 4e-015
Identities = 196/247 (79%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| |||||||||||||| |||| | | | | | || || ||
Sbjct: 261 gtgttccagtagttctttatctcgttgtccgtgcgccaggacaatctccctgcaataaga 202
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| ||||| ||| | | || |||| |||||| ||||| || || | | |
Sbjct: 201 gaccacttgttgccgagaagggagcggagtttgatgatgagctcgtcttcttcttcagag 142
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||||| || |||||||| ||||| || | |||||| |||||||| ||| |||||||||
Sbjct: 141 aagtttccacgcttcagatcgggacgcaagtagtttatccaccggagcttgcagctcttc 82
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcg 1034
||||| |||| ||| || || |||||||| ||||| ||||||| ||||||||||| ||
Sbjct: 81 ccgcatcgcatcagccctgcggccttgggaagcgaacgccagccgccttcgccgtgggct 22
Query: 1035 cggatgt 1041
|||||||
Sbjct: 21 cggatgt 15
>gb|DR057958.1|DR057958 RTNIT1_8_G05.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_8_G05_A029 5', mRNA sequence
Length = 849
Score = 85.7 bits (43), Expect = 4e-015
Identities = 187/235 (79%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 290 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 231
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 230 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 171
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 170 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 111
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgt 1029
||||| | | |||| || || |||||||| || || ||||||| ||||||||||
Sbjct: 110 ccgcatctcggcagccctgcagccttgggaagggaacgccagctgccttcgccgt 56
>gb|DR117116.1|DR117116 RTMG1_4_G10.g1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_4_G10_A029 5', mRNA sequence
Length = 805
Score = 85.7 bits (43), Expect = 4e-015
Identities = 91/107 (85%)
Strand = Plus / Minus
Query: 924 cgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcaccgc 983
|||||||| ||||| || |||||||| ||||| ||||| | ||||||||||||||| | |
Sbjct: 221 cgcttcagatcgggacgcaggtagtttatccatcgcagtctgcagctcttgccgcatctc 162
Query: 984 agcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030
||||| || || |||||||| || || ||||||| ||||||||||||
Sbjct: 161 agcagccctgcggccttgggaagagaacgccagcccccttcgccgtg 115
Score = 61.9 bits (31), Expect = 5e-008
Identities = 34/35 (97%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccg 829
||||||||||||||||| |||||||||||||||||
Sbjct: 350 gtgttccagtagttctttatctcgttgtccgtccg 316
>gb|DR161238.1|DR161238 RTFE1_10_D10.g1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_10_D10_A029 5', mRNA sequence
Length = 766
Score = 85.7 bits (43), Expect = 4e-015
Identities = 91/107 (85%)
Strand = Plus / Minus
Query: 924 cgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcaccgc 983
|||||||| ||||| || |||||||| ||||| ||||| | ||||||||||||||| | |
Sbjct: 220 cgcttcagatcgggacgcaggtagtttatccatcgcagtctgcagctcttgccgcatctc 161
Query: 984 agcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030
||||| || || |||||||| || || ||||||| ||||||||||||
Sbjct: 160 agcagccctgcggccttgggaagagaacgccagctcccttcgccgtg 114
Score = 61.9 bits (31), Expect = 5e-008
Identities = 34/35 (97%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccg 829
||||||||||||||||| |||||||||||||||||
Sbjct: 349 gtgttccagtagttctttatctcgttgtccgtccg 315
>gb|BX679906.1|BX679906 BX679906 RS Pinus pinaster cDNA clone RS36A06, mRNA sequence
Length = 448
Score = 81.8 bits (41), Expect = 6e-014
Identities = 170/213 (79%)
Strand = Plus / Minus
Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850
||||||||||||||| ||||| |||||||||||||| ||||| || | | | | || ||
Sbjct: 369 gtgcgtgttccagtaattctttatctcgttgtccgttcgccctggcaatctccctgcaat 310
Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910
|||||||||||||| ||||||||| ||| || |||| |||||| ||||| || || |
Sbjct: 309 aagcgaccacttgttgccgaggagggagtggagtttgatgatgagatcgtcttcttcttc 250
Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970
| ||| | ||||| ||||| || || || |||||||| ||||| |||| || ||||||
Sbjct: 249 tgaaaagcttccgcgtttcagatcaggacgcaggtagtttatccatcgcaacctgcagct 190
Query: 971 cttgccgcaccgcagcaggcccgccgccttggg 1003
||| || || |||||||| || || ||||||||
Sbjct: 189 cttcccacatcgcagcagccctgcggccttggg 157
>gb|DR164052.1|DR164052 RTFE1_46_B11.g1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_46_B11_A029 5', mRNA sequence
Length = 834
Score = 81.8 bits (41), Expect = 6e-014
Identities = 248/317 (78%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| |||||||||||| |||||||||| | | | || || ||
Sbjct: 370 gtgttccagtagttctttatctcgttgtccatccgccccggcaatcttcctgcaataaga 311
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 310 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 251
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 250 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 191
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcg 1034
||||| | | |||| || || |||||||| || || ||||||| |||||||||| ||
Sbjct: 190 ccgcatctcggcagccctgcagccttgggaagggaacgccagctgccttcgccgttggct 131
Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgc 1094
|| ||||| || | ||||| | ||| || || || ||||| || || ||||||| ||
Sbjct: 130 cgaatgtaagcaatgaggcggtggtcttcttcttttgtccaggcccctttgttggtatga 71
Query: 1095 gccttctcgcagcaggg 1111
|||||||||||||||||
Sbjct: 70 gccttctcgcagcaggg 54
>gb|DR178268.1|DR178268 RTMNUT1_10_C01.g1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_10_C01_A029 5', mRNA sequence
Length = 719
Score = 81.8 bits (41), Expect = 6e-014
Identities = 248/317 (78%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 317 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 258
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | ||
Sbjct: 257 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgta 198
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 197 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 138
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtgcgcg 1034
||||| | | |||| || || |||||||| || || ||||||| |||||||||| ||
Sbjct: 137 ccgcatctcggcagccctgcagccttgggaagggaacgccagctgccttcgccgttggct 78
Query: 1035 cggatgtaggccaccaggcgctcgtcctcctccttggtccacgcgcccctgttggtgtgc 1094
|| ||||| || | ||||| | ||| || || || ||||| || || ||||||| ||
Sbjct: 77 cgaatgtaagcaatgaggcggtggtcttcttcttttgtccaggcccctttgttggtatga 18
Query: 1095 gccttctcgcagcaggg 1111
|||||||||||||||||
Sbjct: 17 gccttctcgcagcaggg 1
>gb|CF385274.1|CF385274 RTDR1_2_D01.g1_A015 Loblolly pine roots recovering from drought DR1
Pinus taeda cDNA clone RTDR1_2_D01_A015 5', mRNA sequence
Length = 703
Score = 77.8 bits (39), Expect = 9e-013
Identities = 177/223 (79%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 225 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 166
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 165 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 106
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 105 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 46
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagc 1017
||||| | | |||| || || |||||||| || || |||||||
Sbjct: 45 ccgcatctcggcagccctgcagccttgggaagggaacgccagc 3
>gb|CF389081.1|CF389081 RTDR2_13_A10.g1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_13_A10_A021 5', mRNA
sequence
Length = 743
Score = 77.8 bits (39), Expect = 9e-013
Identities = 177/223 (79%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 279 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 220
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 219 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 160
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 159 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 100
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagc 1017
||||| | | |||| || || |||||||| || || |||||||
Sbjct: 99 ccgcatctcggcagccctgcagccttgggaagggaacgccagc 57
>gb|CN852309.1|CN852309 Pi148-1 Salicylate-treated slash pine seedlings Pinus elliottii cDNA,
mRNA sequence
Length = 270
Score = 77.8 bits (39), Expect = 9e-013
Identities = 90/107 (84%)
Strand = Plus / Minus
Query: 924 cgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcaccgc 983
|||||||| ||||| || ||||| || ||||| ||||| | ||||||||||||||| | |
Sbjct: 125 cgcttcagatcgggacgcaggtaatttatccatcgcagtctgcagctcttgccgcatctc 66
Query: 984 agcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030
||||| || || |||||||| || || ||||||| ||||||||||||
Sbjct: 65 agcagccctgcggccttgggaagagaacgccagcccccttcgccgtg 19
Score = 61.9 bits (31), Expect = 5e-008
Identities = 34/35 (97%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccg 829
||||||||||||||||| |||||||||||||||||
Sbjct: 254 gtgttccagtagttctttatctcgttgtccgtccg 220
>gb|CO162411.1|CO162411 FLD1_35_D02.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_35_D02_A029 3', mRNA sequence
Length = 717
Score = 77.8 bits (39), Expect = 9e-013
Identities = 186/235 (79%)
Strand = Plus / Plus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 477 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 536
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 537 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 596
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 597 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 656
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgt 1029
||||| | | || | || || |||||||| || || ||||||| ||||||||||
Sbjct: 657 ccgcatctcggcggccctgcagccttgggaagggaacgccagctgccttcgccgt 711
>gb|CX646616.1|CX646616 COLD1_10_A05.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_10_A05_A029 5', mRNA sequence
Length = 887
Score = 77.8 bits (39), Expect = 9e-013
Identities = 186/235 (79%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 322 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 263
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 262 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 203
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 202 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 143
Query: 975 ccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgt 1029
||||| | | || | || || |||||||| || || ||||||| ||||||||||
Sbjct: 142 ccgcatctcggcggccctgcagccttgggaagggaacgccagctgccttcgccgt 88
>gb|CF393923.1|CF393923 RTDS2_2_G07.b1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_2_G07_A021 3', mRNA sequence
Length = 668
Score = 73.8 bits (37), Expect = 1e-011
Identities = 40/41 (97%)
Strand = Plus / Plus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgg 835
||||||||||||||||| |||||||||||||||||||||||
Sbjct: 609 gtgttccagtagttctttatctcgttgtccgtccgccccgg 649
>gb|CO162486.1|CO162486 FLD1_35_D02.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_35_D02_A029 5', mRNA sequence
Length = 779
Score = 73.8 bits (37), Expect = 1e-011
Identities = 40/41 (97%)
Strand = Plus / Plus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgg 835
||||||||||||||||| |||||||||||||||||||||||
Sbjct: 653 gtgttccagtagttctttatctcgttgtccgtccgccccgg 693
>gb|CO198121.1|CO198121 GEO1_11_A02.g1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_11_A02_A029 5', mRNA sequence
Length = 667
Score = 73.8 bits (37), Expect = 1e-011
Identities = 169/213 (79%)
Strand = Plus / Minus
Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850
||||||||||||||| ||||| || ||||||||||| ||||| || | | | | || ||
Sbjct: 305 gtgcgtgttccagtaattctttatttcgttgtccgttcgccctggcaatctccctgcaat 246
Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910
|||||||||||||| ||||||||| ||| || |||| |||||| ||||| || || |
Sbjct: 245 aagcgaccacttgttgccgaggagggagtggagtttgatgatgagatcgtcttcttcttc 186
Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970
| ||| | ||||| ||||| || || || |||||||| ||||| |||| || ||||||
Sbjct: 185 tgaaaagcttccgcgtttcagatcaggacgcaggtagtttatccatcgcaacctgcagct 126
Query: 971 cttgccgcaccgcagcaggcccgccgccttggg 1003
||| || || |||||||| || || ||||||||
Sbjct: 125 cttcccacatcgcagcagccctgcggccttggg 93
>gb|CO361315.1|CO361315 NDL2_4_D03.b1_A029 Needles control 2 Pinus taeda cDNA clone
NDL2_4_D03_A029 3', mRNA sequence
Length = 894
Score = 73.8 bits (37), Expect = 1e-011
Identities = 169/213 (79%)
Strand = Plus / Minus
Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850
||||||||||||||| ||||| || ||||||||||| ||||| || | | | | || ||
Sbjct: 292 gtgcgtgttccagtaattctttatttcgttgtccgttcgccctggcaatctccctgcaat 233
Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910
|||||||||||||| ||||||||| ||| || |||| |||||| ||||| || || |
Sbjct: 232 aagcgaccacttgttgccgaggagggagtggagtttgatgatgagatcgtcttcttcttc 173
Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970
| ||| | ||||| ||||| || || || |||||||| ||||| |||| || ||||||
Sbjct: 172 tgaaaagcttccgcgtttcagatcaggacgcaggtagtttatccatcgcaacctgcagct 113
Query: 971 cttgccgcaccgcagcaggcccgccgccttggg 1003
||| || || |||||||| || || ||||||||
Sbjct: 112 cttcccacatcgcagcagccctgcggccttggg 80
>gb|CO361397.1|CO361397 NDL2_4_D03.g1_A029 Needles control 2 Pinus taeda cDNA clone
NDL2_4_D03_A029 5', mRNA sequence
Length = 804
Score = 73.8 bits (37), Expect = 1e-011
Identities = 169/213 (79%)
Strand = Plus / Minus
Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850
||||||||||||||| ||||| || ||||||||||| ||||| || | | | | || ||
Sbjct: 298 gtgcgtgttccagtaattctttatttcgttgtccgttcgccctggcaatctccctgcaat 239
Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggc 910
|||||||||||||| ||||||||| ||| || |||| |||||| ||||| || || |
Sbjct: 238 aagcgaccacttgttgccgaggagggagtggagtttgatgatgagatcgtcttcttcttc 179
Query: 911 ggtgaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagct 970
| ||| | ||||| ||||| || || || |||||||| ||||| |||| || ||||||
Sbjct: 178 tgaaaagcttccgcgtttcagatcaggacgcaggtagtttatccatcgcaacctgcagct 119
Query: 971 cttgccgcaccgcagcaggcccgccgccttggg 1003
||| || || |||||||| || || ||||||||
Sbjct: 118 cttcccacatcgcagcagccctgcggccttggg 86
>gb|CO367346.1|CO367346 RTK1_33_F05.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_33_F05_A029 5', mRNA sequence
Length = 770
Score = 73.8 bits (37), Expect = 1e-011
Identities = 40/41 (97%)
Strand = Plus / Plus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgg 835
||||||||||||||||| |||||||||||||||||||||||
Sbjct: 698 gtgttccagtagttctttatctcgttgtccgtccgccccgg 738
>gb|CV034016.1|CV034016 RTNACL1_38_B11.b1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_38_B11_A029 3', mRNA sequence
Length = 821
Score = 73.8 bits (37), Expect = 1e-011
Identities = 40/41 (97%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgg 835
||||||||||||||||| |||||||||||||||||||||||
Sbjct: 74 gtgttccagtagttctttatctcgttgtccgtccgccccgg 34
>gb|CX646534.1|CX646534 COLD1_10_A05.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_10_A05_A029 3', mRNA sequence
Length = 785
Score = 73.8 bits (37), Expect = 1e-011
Identities = 40/41 (97%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgg 835
||||||||||||||||| |||||||||||||||||||||||
Sbjct: 54 gtgttccagtagttctttatctcgttgtccgtccgccccgg 14
>gb|CX648339.1|CX648339 COLD1_28_B12.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_28_B12_A029 3', mRNA sequence
Length = 868
Score = 73.8 bits (37), Expect = 1e-011
Identities = 40/41 (97%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgg 835
||||||||||||||||| |||||||||||||||||||||||
Sbjct: 119 gtgttccagtagttctttatctcgttgtccgtccgccccgg 79
>gb|DR057870.1|DR057870 RTNIT1_8_G05.b1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_8_G05_A029 3', mRNA sequence
Length = 802
Score = 73.8 bits (37), Expect = 1e-011
Identities = 40/41 (97%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgg 835
||||||||||||||||| |||||||||||||||||||||||
Sbjct: 73 gtgttccagtagttctttatctcgttgtccgtccgccccgg 33
>gb|DR179654.1|DR179654 RTMNUT1_23_B05.g2_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_23_B05_A029 5', mRNA sequence
Length = 685
Score = 73.8 bits (37), Expect = 1e-011
Identities = 148/185 (80%)
Strand = Plus / Minus
Query: 795 gtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagc 854
||||||||||||||||| ||||||||||||||||||||||| | | | || || ||
Sbjct: 241 gtgttccagtagttctttatctcgttgtccgtccgccccggcaatcttcctgcaataaga 182
Query: 855 gaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtg 914
||||||||||| |||| || | ||| || |||| |||||| ||||| || || | |||
Sbjct: 181 gaccacttgttgccgacgacggagtggagtttgatgatgagttcgtcttcttcttctgtg 122
Query: 915 aagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttg 974
||| | || ||||| || ||||| || |||||||| ||||| ||||||| ||||||||
Sbjct: 121 aagcttccacgcttgagatcgggacgcaggtagtttatccatcgcagcctacagctcttt 62
Query: 975 ccgca 979
|||||
Sbjct: 61 ccgca 57
>gb|CF401126.1|CF401126 RTWW1_10_H02.b1_A015 Well-watered loblolly pine roots WW1 Pinus
taeda cDNA clone RTWW1_10_H02_A015 3', mRNA sequence
Length = 620
Score = 69.9 bits (35), Expect = 2e-010
Identities = 149/187 (79%)
Strand = Plus / Plus
Query: 798 ttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgatgagcgac 857
|||||||||||||| |||||||||||||||||||| || | | | || || || |||
Sbjct: 282 ttccagtagttctttatctcgttgtccgtccgcccgggcaatctgcctgcaataagagac 341
Query: 858 cacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtcctcgtcggcggtgaag 917
|||||||| ||||| ||| ||| || |||| |||||| ||||| || || | | ||||
Sbjct: 342 cacttgttgccgagcagggagtggagtttgatgatgagttcgtcttcttcttctgagaag 401
Query: 918 ttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccg 977
|| || |||||||| || || || |||||||| ||||| || |||| ||||||||| |||
Sbjct: 402 tttccacgcttcagatcaggacgcaggtagtttatccatcggagcctgcagctcttcccg 461
Query: 978 caccgca 984
|| ||||
Sbjct: 462 cagcgca 468
>gb|BX680288.1|BX680288 BX680288 RS Pinus pinaster cDNA clone RS41E09, mRNA sequence
Length = 469
Score = 69.9 bits (35), Expect = 2e-010
Identities = 92/111 (82%)
Strand = Plus / Minus
Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccccgggagccgcgcggcgat 850
||||||||||||||| ||||| |||||||||||||| ||||| || | | | | || ||
Sbjct: 355 gtgcgtgttccagtaattctttatctcgttgtccgttcgccctggcaatctccctgcaat 296
Query: 851 gagcgaccacttgttcccgaggaggctgtgcagcttgacgatgaggtcgtc 901
|||||||||||||| ||||||||| ||| || |||| |||||| |||||
Sbjct: 295 aagcgaccacttgttgccgaggagggagtggagtttgatgatgagatcgtc 245
>gb|BQ701670.1|BQ701670 NXSI_118_C02_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_118_C02 5' similar to Arabidopsis thaliana
sequence At4g38620 putative transcription factor (MYB4)
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 549
Score = 67.9 bits (34), Expect = 8e-010
Identities = 40/42 (95%)
Strand = Plus / Minus
Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccc 832
|||||||||||||| |||||| ||||||||||||||||||||
Sbjct: 358 gtgcgtgttccagtggttctttatctcgttgtccgtccgccc 317
Score = 58.0 bits (29), Expect = 8e-007
Identities = 95/117 (81%)
Strand = Plus / Minus
Query: 914 gaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctctt 973
|||||| || ||||||| ||||| || |||||||| ||||| || |||| ||| || ||
Sbjct: 235 gaagtttccacgcttcaaatcgggacgcaggtagtttatccatcggagcctgcaactttt 176
Query: 974 gccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030
||||||||||||| || || |||||||| || || ||||||| |||||||||||
Sbjct: 175 cccgcaccgcagcaaccctgcggccttgggaagggagcgccagccgccttcgccgtg 119
>gb|CF667045.1|CF667045 RTCNT1_27_G11.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_27_G11_A029 5', mRNA sequence
Length = 744
Score = 67.9 bits (34), Expect = 8e-010
Identities = 40/42 (95%)
Strand = Plus / Minus
Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccc 832
|||||||||||||| |||||| ||||||||||||||||||||
Sbjct: 335 gtgcgtgttccagtggttctttatctcgttgtccgtccgccc 294
Score = 58.0 bits (29), Expect = 8e-007
Identities = 95/117 (81%)
Strand = Plus / Minus
Query: 914 gaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctctt 973
|||||| || ||||||| ||||| || |||||||| ||||| || |||| ||| || ||
Sbjct: 212 gaagtttccacgcttcaaatcgggacgcaggtagtttatccatcggagcctgcaactttt 153
Query: 974 gccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030
||||||||||||| || || |||||||| || || ||||||| |||||||||||
Sbjct: 152 cccgcaccgcagcaaccctgcggccttgggaagggagcgccagccgccttcgccgtg 96
>gb|CO362724.1|CO362724 RTK1_5_A02.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_5_A02_A029 5', mRNA sequence
Length = 326
Score = 67.9 bits (34), Expect = 8e-010
Identities = 79/94 (84%)
Strand = Plus / Minus
Query: 924 cgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctcttgccgcaccgc 983
|||||||| ||||| || |||||||| ||||| ||||| | ||||||||||||||| | |
Sbjct: 250 cgcttcagatcgggacgcaggtagtttatccatcgcagtctgcagctcttgccgcatctc 191
Query: 984 agcaggcccgccgccttgggcagcgaccgccagc 1017
||||| || || |||||||| || || |||||||
Sbjct: 190 agcagccctgcggccttgggaagagaacgccagc 157
>gb|DR014691.1|DR014691 HEAT1_51_B07.b1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_51_B07_A029 3', mRNA sequence
Length = 906
Score = 67.9 bits (34), Expect = 8e-010
Identities = 40/42 (95%)
Strand = Plus / Minus
Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccc 832
|||||||||||||| |||||| ||||||||||||||||||||
Sbjct: 318 gtgcgtgttccagtggttctttatctcgttgtccgtccgccc 277
Score = 58.0 bits (29), Expect = 8e-007
Identities = 95/117 (81%)
Strand = Plus / Minus
Query: 914 gaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctctt 973
|||||| || ||||||| ||||| || |||||||| ||||| || |||| ||| || ||
Sbjct: 195 gaagtttccacgcttcaaatcgggacgcaggtagtttatccatcggagcctgcaactttt 136
Query: 974 gccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030
||||||||||||| || || |||||||| || || ||||||| |||||||||||
Sbjct: 135 cccgcaccgcagcaaccctgcggccttgggaagggagcgccagccgccttcgccgtg 79
>gb|DR014768.1|DR014768 HEAT1_51_B07.g1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_51_B07_A029 5', mRNA sequence
Length = 928
Score = 67.9 bits (34), Expect = 8e-010
Identities = 40/42 (95%)
Strand = Plus / Minus
Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccc 832
|||||||||||||| |||||| ||||||||||||||||||||
Sbjct: 369 gtgcgtgttccagtggttctttatctcgttgtccgtccgccc 328
Score = 58.0 bits (29), Expect = 8e-007
Identities = 95/117 (81%)
Strand = Plus / Minus
Query: 914 gaagttgccgcgcttcaggtcgggccggaggtagttgatccaccgcagccggcagctctt 973
|||||| || ||||||| ||||| || |||||||| ||||| || |||| ||| || ||
Sbjct: 246 gaagtttccacgcttcaaatcgggacgcaggtagtttatccatcggagcctgcaactttt 187
Query: 974 gccgcaccgcagcaggcccgccgccttgggcagcgaccgccagcacccttcgccgtg 1030
||||||||||||| || || |||||||| || || ||||||| |||||||||||
Sbjct: 186 cccgcaccgcagcaaccctgcggccttgggaagggagcgccagccgccttcgccgtg 130
>gb|DR177927.1|DR177927 RTMNUT1_8_E11.b1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_8_E11_A029 3', mRNA sequence
Length = 794
Score = 67.9 bits (34), Expect = 8e-010
Identities = 40/42 (95%)
Strand = Plus / Minus
Query: 791 gtgcgtgttccagtagttcttgatctcgttgtccgtccgccc 832
|||||||||||||| |||||| ||||||||||||||||||||
Sbjct: 118 gtgcgtgttccagtggttctttatctcgttgtccgtccgccc 77
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 141,608
Number of Sequences: 355925
Number of extensions: 141608
Number of successful extensions: 48589
Number of sequences better than 0.5: 152
Number of HSP's better than 0.5 without gapping: 151
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 48273
Number of HSP's gapped (non-prelim): 302
length of query: 1121
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1102
effective length of database: 210,514,662
effective search space: 231987157524
effective search space used: 231987157524
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)