BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2835489.2.1
(885 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF666460.1|CF666460 RTCNT1_23_A10.g1_A029 Root control P... 54 1e-005
gb|BF516660.1|BF516660 NXSI_001_G06_F NXSI (Nsf Xylem Side ... 48 6e-004
gb|CO162180.1|CO162180 FLD1_33_D11.g1_A029 Root flooded Pin... 46 0.002
dbj|BD224350.1| Materials and methods for the modification ... 46 0.002
dbj|BD224413.1| Materials and methods for the modification ... 46 0.002
gb|BG318257.1|BG318257 NXPV_009_E06_F NXPV (Nsf Xylem Plani... 40 0.15
gb|CD022621.1|CD022621 NXPV_074_A09_F NXPV (Nsf Xylem Plani... 40 0.15
gb|CD023217.1|CD023217 NXPV_103_C08_F NXPV (Nsf Xylem Plani... 40 0.15
gb|DR018410.1|DR018410 STRS1_22_G03.g1_A034 Shoot tip pitch... 40 0.15
gb|DR024206.1|DR024206 STRS1_63_B11.b1_A034 Shoot tip pitch... 40 0.15
gb|DR024240.1|DR024240 STRS1_63_B11.g1_A034 Shoot tip pitch... 40 0.15
gb|DR050941.1|DR050941 RTBOR1_26_E05.g1_A029 Roots plus add... 40 0.15
gb|DR068751.1|DR068751 RTDK1_2_E04.g1_A029 Roots, dark Pinu... 40 0.15
>gb|CF666460.1|CF666460 RTCNT1_23_A10.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_23_A10_A029 5', mRNA sequence
Length = 780
Score = 54.0 bits (27), Expect = 1e-005
Identities = 69/83 (83%)
Strand = Plus / Minus
Query: 588 gttatttttccactgtctccatgccatgctatcgtccagccaccacattgatatccaata 647
||||| |||||||| ||| |||||| | |||||||| |||||||||||||| || | |
Sbjct: 692 gttatgtttccacttaatccttgccattccatcgtccatccaccacattgataacccaga 633
Query: 648 tcatcagcatgtgttcctgcaac 670
| ||||| ||| |||||||||||
Sbjct: 632 ttatcaggatgggttcctgcaac 610
>gb|BF516660.1|BF516660 NXSI_001_G06_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_001_G06 5' similar to Arabidopsis thaliana
sequence At5g20950 beta-D-glucan exohydrolase-like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 422
Score = 48.1 bits (24), Expect = 6e-004
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 609 tgccatgctatcgtccagccaccacattgata 640
|||||| |||||||||| ||||||||||||||
Sbjct: 198 tgccattctatcgtccatccaccacattgata 167
>gb|CO162180.1|CO162180 FLD1_33_D11.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_33_D11_A029 5', mRNA sequence
Length = 846
Score = 46.1 bits (23), Expect = 0.002
Identities = 68/83 (81%)
Strand = Plus / Minus
Query: 588 gttatttttccactgtctccatgccatgctatcgtccagccaccacattgatatccaata 647
||||| |||||||| ||| |||||| | |||||||| |||||||| ||||| || | |
Sbjct: 89 gttatgtttccacttaatccttgccattccatcgtccatccaccacactgataacccaga 30
Query: 648 tcatcagcatgtgttcctgcaac 670
| ||||| ||| |||||||||||
Sbjct: 29 ttatcaggatgggttcctgcaac 7
>dbj|BD224350.1| Materials and methods for the modification of plant lignin content
Length = 545
Score = 46.1 bits (23), Expect = 0.002
Identities = 68/83 (81%)
Strand = Plus / Minus
Query: 588 gttatttttccactgtctccatgccatgctatcgtccagccaccacattgatatccaata 647
||||| |||||||| ||| |||||| | |||||||| |||||||| ||||| || | |
Sbjct: 250 gttatgtttccacttaatccttgccattccatcgtccatccaccacactgataacccaga 191
Query: 648 tcatcagcatgtgttcctgcaac 670
| ||||| ||| |||||||||||
Sbjct: 190 ttatcaggatgggttcctgcaac 168
>dbj|BD224413.1| Materials and methods for the modification of plant lignin content
Length = 528
Score = 46.1 bits (23), Expect = 0.002
Identities = 68/83 (81%)
Strand = Plus / Minus
Query: 588 gttatttttccactgtctccatgccatgctatcgtccagccaccacattgatatccaata 647
||||| |||||||| ||| |||||| | |||||||| |||||||| ||||| || | |
Sbjct: 233 gttatgtttccacttaatccttgccattccatcgtccatccaccacactgataacccaga 174
Query: 648 tcatcagcatgtgttcctgcaac 670
| ||||| ||| |||||||||||
Sbjct: 173 ttatcaggatgggttcctgcaac 151
>gb|BG318257.1|BG318257 NXPV_009_E06_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_009_E06 5', mRNA sequence
Length = 537
Score = 40.1 bits (20), Expect = 0.15
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 811 attggtctgaaaatggatgc 830
||||||||||||||||||||
Sbjct: 30 attggtctgaaaatggatgc 11
>gb|CD022621.1|CD022621 NXPV_074_A09_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_074_A09 5', mRNA sequence
Length = 107
Score = 40.1 bits (20), Expect = 0.15
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 811 attggtctgaaaatggatgc 830
||||||||||||||||||||
Sbjct: 56 attggtctgaaaatggatgc 37
>gb|CD023217.1|CD023217 NXPV_103_C08_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_103_C08 5', mRNA sequence
Length = 168
Score = 40.1 bits (20), Expect = 0.15
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 811 attggtctgaaaatggatgc 830
||||||||||||||||||||
Sbjct: 56 attggtctgaaaatggatgc 37
>gb|DR018410.1|DR018410 STRS1_22_G03.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_22_G03_A034 5', mRNA sequence
Length = 747
Score = 40.1 bits (20), Expect = 0.15
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 609 tgccatgctatcgtccagccaccacattgata 640
|||||| |||| ||||| ||||||||||||||
Sbjct: 553 tgccattctattgtccatccaccacattgata 522
>gb|DR024206.1|DR024206 STRS1_63_B11.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_63_B11_A034 3', mRNA sequence
Length = 869
Score = 40.1 bits (20), Expect = 0.15
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 609 tgccatgctatcgtccagccaccacattgata 640
|||||| |||| ||||| ||||||||||||||
Sbjct: 210 tgccattctattgtccatccaccacattgata 179
>gb|DR024240.1|DR024240 STRS1_63_B11.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_63_B11_A034 5', mRNA sequence
Length = 864
Score = 40.1 bits (20), Expect = 0.15
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 609 tgccatgctatcgtccagccaccacattgata 640
|||||| |||| ||||| ||||||||||||||
Sbjct: 522 tgccattctattgtccatccaccacattgata 491
>gb|DR050941.1|DR050941 RTBOR1_26_E05.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_26_E05_A029 5', mRNA sequence
Length = 780
Score = 40.1 bits (20), Expect = 0.15
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 811 attggtctgaaaatggatgc 830
||||||||||||||||||||
Sbjct: 65 attggtctgaaaatggatgc 46
>gb|DR068751.1|DR068751 RTDK1_2_E04.g1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_2_E04_A029 5', mRNA sequence
Length = 780
Score = 40.1 bits (20), Expect = 0.15
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 609 tgccatgctatcgtccagccaccacattgata 640
|||||| |||| ||||| ||||||||||||||
Sbjct: 708 tgccattctattgtccatccaccacattgata 677
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 105,348
Number of Sequences: 355925
Number of extensions: 105348
Number of successful extensions: 28480
Number of sequences better than 0.5: 14
Number of HSP's better than 0.5 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 28452
Number of HSP's gapped (non-prelim): 28
length of query: 885
length of database: 217,277,237
effective HSP length: 19
effective length of query: 866
effective length of database: 210,514,662
effective search space: 182305697292
effective search space used: 182305697292
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)