BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2763158.2.1
         (826 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CF473781.1|CF473781  RTWW2_4_A04.g1_A021 Well-watered lob...    40   0.14 

>gb|CF473781.1|CF473781 RTWW2_4_A04.g1_A021 Well-watered loblolly pine roots WW2 Pinus
           taeda cDNA clone RTWW2_4_A04_A021 5', mRNA sequence
          Length = 682

 Score = 40.1 bits (20), Expect = 0.14
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 461 tctattggacaacttcgaatggtt 484
           |||||||||||||||||| |||||
Sbjct: 351 tctattggacaacttcgagtggtt 328



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 82,551
Number of Sequences: 355925
Number of extensions: 82551
Number of successful extensions: 22421
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22420
Number of HSP's gapped (non-prelim): 1
length of query: 826
length of database: 217,277,237
effective HSP length: 19
effective length of query: 807
effective length of database: 210,514,662
effective search space: 169885332234
effective search space used: 169885332234
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)