BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2590996.2.1
(1086 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO159644.1|CO159644 FLD1_14_H03.g1_A029 Root flooded Pin... 60 2e-007
gb|DR024314.1|DR024314 STRS1_64_C03.b1_A034 Shoot tip pitch... 60 2e-007
gb|BX249118.1|BX249118 BX249118 Pinus pinaster differenciat... 50 2e-004
gb|BX255284.1|BX255284 BX255284 Pinus pinaster differenciat... 50 2e-004
gb|BX255181.1|BX255181 BX255181 Pinus pinaster differenciat... 46 0.003
gb|BE644117.1|BE644117 NXCI_054_F12_F NXCI (Nsf Xylem Compr... 46 0.003
gb|BF010920.1|BF010920 NXCI_094_F10_F NXCI (Nsf Xylem Compr... 46 0.003
gb|CV033662.1|CV033662 RTNACL1_35_H05.g1_A029 Roots plus ad... 44 0.012
gb|BX253864.1|BX253864 BX253864 Pinus pinaster differenciat... 42 0.047
gb|BE187204.1|BE187204 NXNV_160_E12_F Nsf Xylem Normal wood... 42 0.047
gb|BE187215.1|BE187215 NXNV_160_F11_F Nsf Xylem Normal wood... 42 0.047
gb|BQ655029.1|BQ655029 NXRV089_C12_F NXRV (Nsf Xylem Root w... 42 0.047
dbj|BD224494.1| Materials and methods for the modification ... 42 0.047
gb|BX676981.1|BX676981 BX676981 RN Pinus pinaster cDNA clon... 40 0.19
>gb|CO159644.1|CO159644 FLD1_14_H03.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_14_H03_A029 5', mRNA sequence
Length = 773
Score = 60.0 bits (30), Expect = 2e-007
Identities = 63/74 (85%)
Strand = Plus / Minus
Query: 475 gtctgctgctcggcgaagaagggccagcacagcatgggaacgccgccgcaaatactctcc 534
||||| ||||| || ||||||||||| |||| |||||||||||| |||| || ||||||
Sbjct: 744 gtctgttgctccgcaaagaagggccaacacatcatgggaacgcccgcgcatatgctctcc 685
Query: 535 agcgtggagttcca 548
| |||||||||||
Sbjct: 684 actgtggagttcca 671
>gb|DR024314.1|DR024314 STRS1_64_C03.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_64_C03_A034 3', mRNA sequence
Length = 729
Score = 60.0 bits (30), Expect = 2e-007
Identities = 66/78 (84%)
Strand = Plus / Minus
Query: 471 gttggtctgctgctcggcgaagaagggccagcacagcatgggaacgccgccgcaaatact 530
|||||||||||| ||||| |||||||||||||| | ||||||||| || |||| || ||
Sbjct: 384 gttggtctgctgttcggcaaagaagggccagcagatcatgggaacacccgcgcatatgct 325
Query: 531 ctccagcgtggagttcca 548
||| | |||||||||||
Sbjct: 324 ctcgacagtggagttcca 307
>gb|BX249118.1|BX249118 BX249118 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP020C02 similar to Flavonol 3 O
glucosyltransferase, mRNA sequence
Length = 521
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 481 tgctcggcgaagaagggccagcaca 505
|||||||||||||||||||||||||
Sbjct: 69 tgctcggcgaagaagggccagcaca 45
>gb|BX255284.1|BX255284 BX255284 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP004A03 similar to Flavonol 3 O
glucosyltransferase, mRNA sequence
Length = 592
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 481 tgctcggcgaagaagggccagcaca 505
|||||||||||||||||||||||||
Sbjct: 328 tgctcggcgaagaagggccagcaca 304
>gb|BX255181.1|BX255181 BX255181 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP112D05 similar to Flavonol 3 O
glucosyltransferase 5, mRNA sequence
Length = 687
Score = 46.1 bits (23), Expect = 0.003
Identities = 59/71 (83%)
Strand = Plus / Minus
Query: 481 tgctcggcgaagaagggccagcacagcatgggaacgccgccgcaaatactctccagcgtg 540
|||||||| |||||||||||||||| ||| || || || ||| || || |||| ||||
Sbjct: 299 tgctcggcaaagaagggccagcacatcattggcacacccgcgctgatgctttccaacgtg 240
Query: 541 gagttccaccc 551
|||||||||||
Sbjct: 239 gagttccaccc 229
>gb|BE644117.1|BE644117 NXCI_054_F12_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_054_F12 5' similar to Arabidopsis
thaliana sequence At1g78270 similar to glucoronosyl
transferase-like protein; similar to ESTs gb|AI996767.1,
emb|Z46520.1, gb|T44500.1, and gb|AI099822.1 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 365
Score = 46.1 bits (23), Expect = 0.003
Identities = 59/71 (83%)
Strand = Plus / Minus
Query: 481 tgctcggcgaagaagggccagcacagcatgggaacgccgccgcaaatactctccagcgtg 540
|||||||| |||||||||||||||| ||| || || || ||| || || |||| ||||
Sbjct: 208 tgctcggcaaagaagggccagcacatcattggcacacccgcgctgatgctttccaacgtg 149
Query: 541 gagttccaccc 551
|||||||||||
Sbjct: 148 gagttccaccc 138
>gb|BF010920.1|BF010920 NXCI_094_F10_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_094_F10 5' similar to Arabidopsis
thaliana sequence At1g22400 Putative UDP-glucose
glucosyltransferase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 296
Score = 46.1 bits (23), Expect = 0.003
Identities = 59/71 (83%)
Strand = Plus / Minus
Query: 481 tgctcggcgaagaagggccagcacagcatgggaacgccgccgcaaatactctccagcgtg 540
|||||||| |||||||||||||||| ||| || || || ||| || || |||| ||||
Sbjct: 265 tgctcggcaaagaagggccagcacatcattggcacacccgcgctgatgctttccaacgtg 206
Query: 541 gagttccaccc 551
|||||||||||
Sbjct: 205 gagttccaccc 195
>gb|CV033662.1|CV033662 RTNACL1_35_H05.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_35_H05_A029 5', mRNA sequence
Length = 445
Score = 44.1 bits (22), Expect = 0.012
Identities = 31/34 (91%)
Strand = Plus / Minus
Query: 529 ctctccagcgtggagttccacccggagtgcgtca 562
|||||||||||||||||||| ||| |||| ||||
Sbjct: 252 ctctccagcgtggagttccaaccgcagtgggtca 219
>gb|BX253864.1|BX253864 BX253864 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP089F10 similar to Flavonol 3 O
glucosyltransferase, mRNA sequence
Length = 687
Score = 42.1 bits (21), Expect = 0.047
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 481 tgctcggcgaagaagggccagcaca 505
|||||||| ||||||||||||||||
Sbjct: 465 tgctcggcaaagaagggccagcaca 441
>gb|BE187204.1|BE187204 NXNV_160_E12_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_160_E12 5' similar to Arabidopsis thaliana
sequence At1g22340 hypothetical protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 533
Score = 42.1 bits (21), Expect = 0.047
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 481 tgctcggcgaagaagggccagcaca 505
|||||||| ||||||||||||||||
Sbjct: 196 tgctcggcaaagaagggccagcaca 172
>gb|BE187215.1|BE187215 NXNV_160_F11_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_160_F11 5' similar to Arabidopsis thaliana
sequence At1g78270 similar to glucoronosyl
transferase-like protein; similar to ESTs gb|AI996767.1,
emb|Z46520.1, gb|T44500.1, and gb|AI099822.1 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 330
Score = 42.1 bits (21), Expect = 0.047
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 481 tgctcggcgaagaagggccagcaca 505
|||||||| ||||||||||||||||
Sbjct: 196 tgctcggcaaagaagggccagcaca 172
>gb|BQ655029.1|BQ655029 NXRV089_C12_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV089_C12 5' similar to Arabidopsis thaliana
sequence At1g22340 hypothetical protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 477
Score = 42.1 bits (21), Expect = 0.047
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 481 tgctcggcgaagaagggccagcaca 505
|||||||| ||||||||||||||||
Sbjct: 75 tgctcggcaaagaagggccagcaca 51
>dbj|BD224494.1| Materials and methods for the modification of plant lignin content
Length = 762
Score = 42.1 bits (21), Expect = 0.047
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 481 tgctcggcgaagaagggccagcaca 505
|||||||| ||||||||||||||||
Sbjct: 298 tgctcggcaaagaagggccagcaca 274
>gb|BX676981.1|BX676981 BX676981 RN Pinus pinaster cDNA clone RN15E7, mRNA sequence
Length = 565
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 529 ctctccagcgtggagttcca 548
||||||||||||||||||||
Sbjct: 317 ctctccagcgtggagttcca 298
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 80,747
Number of Sequences: 355925
Number of extensions: 80747
Number of successful extensions: 18220
Number of sequences better than 0.5: 15
Number of HSP's better than 0.5 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18200
Number of HSP's gapped (non-prelim): 17
length of query: 1086
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1067
effective length of database: 210,514,662
effective search space: 224619144354
effective search space used: 224619144354
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)