BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2493944.2.1
         (2055 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|DR014430.1|DR014430  HEAT1_49_A07.g1_A029 Root at 37 C fo...    68   2e-009
gb|DR102156.1|DR102156  STRR1_78_H02.g1_A033 Stem Response R...    48   0.001
gb|DR690351.1|DR690351  EST1080437 Normalized pine embryo li...    44   0.023
gb|DT636133.1|DT636133  EST1151064 Normalized pine embryo li...    44   0.023

>gb|DR014430.1|DR014430 HEAT1_49_A07.g1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
            HEAT1_49_A07_A029 5', mRNA sequence
          Length = 914

 Score = 67.9 bits (34), Expect = 2e-009
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                        
Query: 1760 tagaagaaatggtaccaccccttgtagtacatgggcgcgttgggatcattgatccagttc 1819
            ||||||||||||||  | ||||||||| |||||||||| || |||||||| |||||||||
Sbjct: 128  tagaagaaatggtagtatcccttgtagaacatgggcgcatttggatcattcatccagttc 69

              
Query: 1820 tt 1821
            ||
Sbjct: 68   tt 67



>gb|DR102156.1|DR102156 STRR1_78_H02.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
            STRR1_78_H02_A033 5', mRNA sequence
          Length = 603

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 60/72 (83%)
 Strand = Plus / Minus

                                                                        
Query: 1744 cttgggattgtattggtagaagaaatggtaccaccccttgtagtacatgggcgcgttggg 1803
            ||||||||| ||||||||||| ||||| ||  | ||||||||| | |  ||||| |||||
Sbjct: 241  cttgggattatattggtagaacaaatgatagtagcccttgtagaataatggcgcattggg 182

                        
Query: 1804 atcattgatcca 1815
            |||||| |||||
Sbjct: 181  atcattcatcca 170



>gb|DR690351.1|DR690351 EST1080437 Normalized pine embryo library, Lib_D Pinus taeda cDNA
            clone PWACU06 3' end, mRNA sequence
          Length = 908

 Score = 44.1 bits (22), Expect = 0.023
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 1231 caccgggtagaagtcagggcactcccacat 1260
            |||||||||||| || ||||||||||||||
Sbjct: 52   caccgggtagaaatccgggcactcccacat 23



>gb|DT636133.1|DT636133 EST1151064 Normalized pine embryo library, Lib_D Pinus taeda cDNA
            clone PIMGO37 3' end, mRNA sequence
          Length = 870

 Score = 44.1 bits (22), Expect = 0.023
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 1231 caccgggtagaagtcagggcactcccacat 1260
            |||||||||||| || ||||||||||||||
Sbjct: 60   caccgggtagaaatccgggcactcccacat 31



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 181,118
Number of Sequences: 355925
Number of extensions: 181118
Number of successful extensions: 55850
Number of sequences better than  0.5: 4
Number of HSP's better than  0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55840
Number of HSP's gapped (non-prelim): 10
length of query: 2055
length of database: 217,277,237
effective HSP length: 20
effective length of query: 2035
effective length of database: 210,158,737
effective search space: 427673029795
effective search space used: 427673029795
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)