BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2441327.2.1
(884 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BF010556.1|BF010556 NXCI_085_H12_F NXCI (Nsf Xylem Compr... 46 0.002
gb|DR097770.1|DR097770 STRR1_36_H02.g3_A033 Stem Response R... 46 0.002
gb|DR689922.1|DR689922 EST1080008 Normalized pine embryo li... 46 0.002
gb|DT636076.1|DT636076 EST1151007 Normalized pine embryo li... 46 0.002
gb|CO158292.1|CO158292 FLD1_6_B02.b1_A029 Root flooded Pinu... 44 0.010
gb|CO158862.1|CO158862 FLD1_9_F07.g1_A029 Root flooded Pinu... 44 0.010
gb|DR016733.1|DR016733 STRS1_11_G08.g1_A034 Shoot tip pitch... 44 0.010
gb|DR019732.1|DR019732 STRS1_32_C01.b1_A034 Shoot tip pitch... 44 0.010
gb|DR019805.1|DR019805 STRS1_32_C01.g1_A034 Shoot tip pitch... 44 0.010
gb|CF393171.1|CF393171 RTDR3_17_B11.g1_A022 Loblolly pine r... 42 0.038
gb|CF396342.1|CF396342 RTDS2_21_E10.g1_A021 Drought-stresse... 42 0.038
gb|CO159680.1|CO159680 FLD1_15_C10.b1_A029 Root flooded Pin... 42 0.038
gb|CO159747.1|CO159747 FLD1_15_C10.g1_A029 Root flooded Pin... 42 0.038
gb|CO164757.1|CO164757 FLD1_50_D01.b1_A029 Root flooded Pin... 42 0.038
gb|CO164832.1|CO164832 FLD1_50_D01.g1_A029 Root flooded Pin... 42 0.038
gb|CO166900.1|CO166900 FLD1_65_H01.b1_A029 Root flooded Pin... 42 0.038
gb|CO166975.1|CO166975 FLD1_65_H01.g1_A029 Root flooded Pin... 42 0.038
gb|CO197347.1|CO197347 GEO1_5_D12.g1_A029 Root gravitropism... 42 0.038
gb|CO366554.1|CO366554 RTK1_28_C07.g1_A029 Roots minus pota... 42 0.038
gb|CV035746.1|CV035746 RTNACL1_42_D12.b1_A029 Roots plus ad... 42 0.038
gb|CV035822.1|CV035822 RTNACL1_42_D12.g1_A029 Roots plus ad... 42 0.038
gb|CX645739.1|CX645739 COLD1_5_B10.b1_A029 Root cold Pinus ... 42 0.038
gb|CX645749.1|CX645749 COLD1_5_C10.b1_A029 Root cold Pinus ... 42 0.038
gb|CX645824.1|CX645824 COLD1_5_B10.g1_A029 Root cold Pinus ... 42 0.038
gb|CX645836.1|CX645836 COLD1_5_C10.g1_A029 Root cold Pinus ... 42 0.038
gb|CX649770.1|CX649770 COLD1_41_H10.b1_A029 Root cold Pinus... 42 0.038
gb|CX649858.1|CX649858 COLD1_41_H10.g1_A029 Root cold Pinus... 42 0.038
gb|DR013697.1|DR013697 HEAT1_21_A02.b1_A029 Root at 37 C fo... 42 0.038
gb|DR013772.1|DR013772 HEAT1_21_A02.g1_A029 Root at 37 C fo... 42 0.038
gb|DR018476.1|DR018476 STRS1_23_G05.b1_A034 Shoot tip pitch... 42 0.038
gb|DR020699.1|DR020699 STRS1_38_E11.g1_A034 Shoot tip pitch... 42 0.038
gb|DR024683.1|DR024683 STRS1_66_F12.g1_A034 Shoot tip pitch... 42 0.038
gb|DR048661.1|DR048661 RTBOR1_10_H07.b1_A029 Roots plus add... 42 0.038
gb|DR048736.1|DR048736 RTBOR1_10_H07.g1_A029 Roots plus add... 42 0.038
gb|DR048818.1|DR048818 RTBOR1_11_A08.g1_A029 Roots plus add... 42 0.038
gb|DR048999.1|DR048999 RTBOR1_12_C09.g1_A029 Roots plus add... 42 0.038
gb|DR050101.1|DR050101 RTBOR1_21_F11.b1_A029 Roots plus add... 42 0.038
gb|DR050180.1|DR050180 RTBOR1_21_F11.g1_A029 Roots plus add... 42 0.038
gb|DR050841.1|DR050841 RTBOR1_26_B03.b1_A029 Roots plus add... 42 0.038
gb|DR050915.1|DR050915 RTBOR1_26_B03.g1_A029 Roots plus add... 42 0.038
gb|DR051866.1|DR051866 RTCA1_1_A03.b1_A029 Roots minus calc... 42 0.038
gb|DR051941.1|DR051941 RTCA1_1_A03.g1_A029 Roots minus calc... 42 0.038
gb|DR053602.1|DR053602 RTCA1_12_E05.b1_A029 Roots minus cal... 42 0.038
gb|DR053684.1|DR053684 RTCA1_12_E05.g1_A029 Roots minus cal... 42 0.038
gb|DR058578.1|DR058578 RTNIT1_12_E01.g1_A029 Roots minus ni... 42 0.038
gb|DR093333.1|DR093333 STRR1_7_D01.g1_A033 Stem Response Re... 42 0.038
gb|DR098540.1|DR098540 STRR1_46_E08.b1_A033 Stem Response R... 42 0.038
gb|DR098607.1|DR098607 STRR1_46_E08.g1_A033 Stem Response R... 42 0.038
gb|DR168807.1|DR168807 RTPHOS1_28_A09.b1_A029 Roots minus p... 42 0.038
gb|DR168879.1|DR168879 RTPHOS1_28_A09.g1_A029 Roots minus p... 42 0.038
gb|DR179239.1|DR179239 RTMNUT1_16_H05.g1_A029 Roots minus m... 42 0.038
gb|DR386770.1|DR386770 RTHG1_17_G10.b1_A029 Roots plus adde... 42 0.038
gb|DR386855.1|DR386855 RTHG1_17_G10.g1_A029 Roots plus adde... 42 0.038
gb|AW010234.1|AW010234 ST03F06 Pine TriplEx shoot tip libra... 40 0.15
gb|CF395690.1|CF395690 RTDS2_16_A02.g1_A021 Drought-stresse... 40 0.15
gb|CF664978.1|CF664978 RTCNT1_13_C10.b1_A029 Root control P... 40 0.15
gb|CF665055.1|CF665055 RTCNT1_13_C10.g1_A029 Root control P... 40 0.15
gb|CF665536.1|CF665536 RTCNT1_16_D05.g1_A029 Root control P... 40 0.15
gb|CF666144.1|CF666144 RTCNT1_21_D05.b1_A029 Root control P... 40 0.15
gb|CF666205.1|CF666205 RTCNT1_21_D05.g1_A029 Root control P... 40 0.15
gb|CF667732.1|CF667732 RTCNT1_32_E07.b1_A029 Root control P... 40 0.15
gb|CF667817.1|CF667817 RTCNT1_32_E07.g1_A029 Root control P... 40 0.15
gb|CF668197.1|CF668197 RTCNT1_35_B06.b1_A029 Root control P... 40 0.15
gb|CF668641.1|CF668641 RTCNT1_37_F07.g1_A029 Root control P... 40 0.15
gb|CF670972.1|CF670972 RTCNT1_53_G07.g1_A029 Root control P... 40 0.15
gb|CO164769.1|CO164769 FLD1_50_E04.b1_A029 Root flooded Pin... 40 0.15
gb|CO167625.1|CO167625 FLD1_70_D02.b1_A029 Root flooded Pin... 40 0.15
gb|CO169071.1|CO169071 NDL1_4_B06.g1_A029 Needles control P... 40 0.15
gb|CX647534.1|CX647534 COLD1_17_A03.g1_A029 Root cold Pinus... 40 0.15
gb|CX649701.1|CX649701 COLD1_41_A07.b1_A029 Root cold Pinus... 40 0.15
gb|CX649777.1|CX649777 COLD1_41_A07.g1_A029 Root cold Pinus... 40 0.15
gb|CX653214.1|CX653214 COLD1_64_D05.b1_A029 Root cold Pinus... 40 0.15
gb|CX653288.1|CX653288 COLD1_64_D05.g1_A029 Root cold Pinus... 40 0.15
gb|DR010884.1|DR010884 HEAT1_2_A05.b1_A029 Root at 37 C for... 40 0.15
gb|DR010961.1|DR010961 HEAT1_2_A05.g1_A029 Root at 37 C for... 40 0.15
gb|DR051113.1|DR051113 RTBOR1_27_F04.g1_A029 Roots plus add... 40 0.15
gb|DR053024.1|DR053024 RTCA1_8_B11.g1_A029 Roots minus calc... 40 0.15
gb|DR068567.1|DR068567 RTDK1_1_C09.g1_A029 Roots, dark Pinu... 40 0.15
gb|DR161647.1|DR161647 RTFE1_13_C07.b1_A029 Roots minus iro... 40 0.15
>gb|BF010556.1|BF010556 NXCI_085_H12_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_085_H12 5' similar to Arabidopsis
thaliana sequence At1g10360 putative glutathione
S-transferase TSI-1 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 390
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 309 gacccctacgaccgcgccattgctcgcttctgggc 343
||||| || ||||| ||||||||||||||||||||
Sbjct: 143 gacccatatgaccgagccattgctcgcttctgggc 177
>gb|DR097770.1|DR097770 STRR1_36_H02.g3_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_36_H02_A033 5', mRNA sequence
Length = 913
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 309 gacccctacgaccgcgccattgctcgcttctgggc 343
||||| || ||||| ||||||||||||||||||||
Sbjct: 305 gacccatatgaccgagccattgctcgcttctgggc 339
>gb|DR689922.1|DR689922 EST1080008 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWACP02 3' end, mRNA sequence
Length = 812
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 309 gacccctacgaccgcgccattgctcgcttctgggc 343
||||| || ||||| ||||||||||||||||||||
Sbjct: 335 gacccatatgaccgagccattgctcgcttctgggc 369
>gb|DT636076.1|DT636076 EST1151007 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMGN75 3' end, mRNA sequence
Length = 774
Score = 46.1 bits (23), Expect = 0.002
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 309 gacccctacgaccgcgccattgctcgcttctgggc 343
||||| || ||||| ||||||||||||||||||||
Sbjct: 343 gacccatatgaccgagccattgctcgcttctgggc 377
>gb|CO158292.1|CO158292 FLD1_6_B02.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_6_B02_A029 3', mRNA sequence
Length = 643
Score = 44.1 bits (22), Expect = 0.010
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 318 gaccgcgccattgctcgcttctgggc 343
||||| ||||||||||||||||||||
Sbjct: 20 gaccgagccattgctcgcttctgggc 45
>gb|CO158862.1|CO158862 FLD1_9_F07.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_9_F07_A029 5', mRNA sequence
Length = 817
Score = 44.1 bits (22), Expect = 0.010
Identities = 37/42 (88%)
Strand = Plus / Plus
Query: 197 caagaaggtgcccgtgctcatccaccacggcaagcccgtctg 238
||||||| | || |||||||||||| |||||||||| |||||
Sbjct: 150 caagaagattccggtgctcatccacaacggcaagcctgtctg 191
>gb|DR016733.1|DR016733 STRS1_11_G08.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_11_G08_A034 5', mRNA sequence
Length = 920
Score = 44.1 bits (22), Expect = 0.010
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 318 gaccgcgccattgctcgcttctgggc 343
||||| ||||||||||||||||||||
Sbjct: 306 gaccgagccattgctcgcttctgggc 331
>gb|DR019732.1|DR019732 STRS1_32_C01.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_32_C01_A034 3', mRNA sequence
Length = 721
Score = 44.1 bits (22), Expect = 0.010
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 318 gaccgcgccattgctcgcttctgggc 343
||||| ||||||||||||||||||||
Sbjct: 141 gaccgagccattgctcgcttctgggc 166
>gb|DR019805.1|DR019805 STRS1_32_C01.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_32_C01_A034 5', mRNA sequence
Length = 722
Score = 44.1 bits (22), Expect = 0.010
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 318 gaccgcgccattgctcgcttctgggc 343
||||| ||||||||||||||||||||
Sbjct: 299 gaccgagccattgctcgcttctgggc 324
>gb|CF393171.1|CF393171 RTDR3_17_B11.g1_A022 Loblolly pine roots recovering from drought
DR3 Pinus taeda cDNA clone RTDR3_17_B11_A022 5', mRNA
sequence
Length = 674
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 318 tacgaccgagccattgcccgcttctgggc 346
>gb|CF396342.1|CF396342 RTDS2_21_E10.g1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_21_E10_A021 5', mRNA sequence
Length = 722
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 209 tacgaccgagccattgcccgcttctgggc 237
>gb|CO159680.1|CO159680 FLD1_15_C10.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_15_C10_A029 3', mRNA sequence
Length = 765
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 171 tacgaccgagccattgcccgcttctgggc 199
>gb|CO159747.1|CO159747 FLD1_15_C10.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_15_C10_A029 5', mRNA sequence
Length = 838
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 337 tacgaccgagccattgcccgcttctgggc 365
>gb|CO164757.1|CO164757 FLD1_50_D01.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_50_D01_A029 3', mRNA sequence
Length = 878
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 300 tacgaccgagccattgcccgcttctgggc 328
>gb|CO164832.1|CO164832 FLD1_50_D01.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_50_D01_A029 5', mRNA sequence
Length = 854
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 354 tacgaccgagccattgcccgcttctgggc 382
>gb|CO166900.1|CO166900 FLD1_65_H01.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_65_H01_A029 3', mRNA sequence
Length = 797
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 77 tacgaccgagccattgcccgcttctgggc 105
>gb|CO166975.1|CO166975 FLD1_65_H01.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_65_H01_A029 5', mRNA sequence
Length = 852
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 320 tacgaccgagccattgcccgcttctgggc 348
>gb|CO197347.1|CO197347 GEO1_5_D12.g1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_5_D12_A029 5', mRNA sequence
Length = 802
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 320 tacgaccgagccattgcccgcttctgggc 348
>gb|CO366554.1|CO366554 RTK1_28_C07.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_28_C07_A029 5', mRNA sequence
Length = 867
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 315 tacgaccgagccattgcccgcttctgggc 343
>gb|CV035746.1|CV035746 RTNACL1_42_D12.b1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_42_D12_A029 3', mRNA sequence
Length = 778
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 105 tacgaccgagccattgcccgcttctgggc 133
>gb|CV035822.1|CV035822 RTNACL1_42_D12.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_42_D12_A029 5', mRNA sequence
Length = 819
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 320 tacgaccgagccattgcccgcttctgggc 348
>gb|CX645739.1|CX645739 COLD1_5_B10.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_5_B10_A029 3', mRNA sequence
Length = 808
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 122 tacgaccgagccattgcccgcttctgggc 150
>gb|CX645749.1|CX645749 COLD1_5_C10.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_5_C10_A029 3', mRNA sequence
Length = 801
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 115 tacgaccgagccattgcccgcttctgggc 143
>gb|CX645824.1|CX645824 COLD1_5_B10.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_5_B10_A029 5', mRNA sequence
Length = 763
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 320 tacgaccgagccattgcccgcttctgggc 348
>gb|CX645836.1|CX645836 COLD1_5_C10.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_5_C10_A029 5', mRNA sequence
Length = 707
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 318 tacgaccgagccattgcccgcttctgggc 346
>gb|CX649770.1|CX649770 COLD1_41_H10.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_41_H10_A029 3', mRNA sequence
Length = 711
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 346 tacgaccgagccattgcccgcttctgggc 318
>gb|CX649858.1|CX649858 COLD1_41_H10.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_41_H10_A029 5', mRNA sequence
Length = 693
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 681 tacgaccgagccattgcccgcttctgggc 653
>gb|DR013697.1|DR013697 HEAT1_21_A02.b1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_21_A02_A029 3', mRNA sequence
Length = 786
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 133 tacgaccgagccattgcccgcttctgggc 161
>gb|DR013772.1|DR013772 HEAT1_21_A02.g1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_21_A02_A029 5', mRNA sequence
Length = 885
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 312 tacgaccgagccattgcccgcttctgggc 340
>gb|DR018476.1|DR018476 STRS1_23_G05.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_23_G05_A034 3', mRNA sequence
Length = 687
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 36 tacgaccgagccattgcccgcttctgggc 64
>gb|DR020699.1|DR020699 STRS1_38_E11.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_38_E11_A034 5', mRNA sequence
Length = 770
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 319 tacgaccgagccattgcccgcttctgggc 347
>gb|DR024683.1|DR024683 STRS1_66_F12.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_66_F12_A034 5', mRNA sequence
Length = 293
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 256 tacgaccgagccattgcccgcttctgggc 284
>gb|DR048661.1|DR048661 RTBOR1_10_H07.b1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_10_H07_A029 3', mRNA sequence
Length = 798
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 122 tacgaccgagccattgcccgcttctgggc 150
>gb|DR048736.1|DR048736 RTBOR1_10_H07.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_10_H07_A029 5', mRNA sequence
Length = 729
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 327 tacgaccgagccattgcccgcttctgggc 355
>gb|DR048818.1|DR048818 RTBOR1_11_A08.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_11_A08_A029 5', mRNA sequence
Length = 862
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 319 tacgaccgagccattgcccgcttctgggc 347
>gb|DR048999.1|DR048999 RTBOR1_12_C09.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_12_C09_A029 5', mRNA sequence
Length = 492
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 334 tacgaccgagccattgcccgcttctgggc 362
>gb|DR050101.1|DR050101 RTBOR1_21_F11.b1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_21_F11_A029 3', mRNA sequence
Length = 749
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 17 tacgaccgagccattgcccgcttctgggc 45
>gb|DR050180.1|DR050180 RTBOR1_21_F11.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_21_F11_A029 5', mRNA sequence
Length = 781
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 83 tacgaccgagccattgcccgcttctgggc 111
>gb|DR050841.1|DR050841 RTBOR1_26_B03.b1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_26_B03_A029 3', mRNA sequence
Length = 840
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 236 tacgaccgagccattgcccgcttctgggc 264
>gb|DR050915.1|DR050915 RTBOR1_26_B03.g1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_26_B03_A029 5', mRNA sequence
Length = 794
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 297 tacgaccgagccattgcccgcttctgggc 325
>gb|DR051866.1|DR051866 RTCA1_1_A03.b1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_1_A03_A029 3', mRNA sequence
Length = 902
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 197 tacgaccgagccattgcccgcttctgggc 225
>gb|DR051941.1|DR051941 RTCA1_1_A03.g1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_1_A03_A029 5', mRNA sequence
Length = 903
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 313 tacgaccgagccattgcccgcttctgggc 341
>gb|DR053602.1|DR053602 RTCA1_12_E05.b1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_12_E05_A029 3', mRNA sequence
Length = 705
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 70 tacgaccgagccattgcccgcttctgggc 98
>gb|DR053684.1|DR053684 RTCA1_12_E05.g1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_12_E05_A029 5', mRNA sequence
Length = 588
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 336 tacgaccgagccattgcccgcttctgggc 364
>gb|DR058578.1|DR058578 RTNIT1_12_E01.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_12_E01_A029 5', mRNA sequence
Length = 803
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 310 tacgaccgagccattgcccgcttctgggc 338
>gb|DR093333.1|DR093333 STRR1_7_D01.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_7_D01_A033 5', mRNA sequence
Length = 885
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 290 tacgaccgagccattgcccgcttctgggc 318
>gb|DR098540.1|DR098540 STRR1_46_E08.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_46_E08_A033 3', mRNA sequence
Length = 834
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 228 tacgaccgagccattgcccgcttctgggc 256
>gb|DR098607.1|DR098607 STRR1_46_E08.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_46_E08_A033 5', mRNA sequence
Length = 841
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 300 tacgaccgagccattgcccgcttctgggc 328
>gb|DR168807.1|DR168807 RTPHOS1_28_A09.b1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_28_A09_A029 3', mRNA sequence
Length = 757
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 88 tacgaccgagccattgcccgcttctgggc 116
>gb|DR168879.1|DR168879 RTPHOS1_28_A09.g1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_28_A09_A029 5', mRNA sequence
Length = 689
Score = 42.1 bits (21), Expect = 0.038
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 315 tacgaccgcgccattgctcgcttctgggc 343
|||||||| |||||||| |||||||||||
Sbjct: 300 tacgaccgagccattgcccgcttctgggc 328
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 92,512
Number of Sequences: 355925
Number of extensions: 92512
Number of successful extensions: 21955
Number of sequences better than 0.5: 79
Number of HSP's better than 0.5 without gapping: 79
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 21836
Number of HSP's gapped (non-prelim): 119
length of query: 884
length of database: 217,277,237
effective HSP length: 19
effective length of query: 865
effective length of database: 210,514,662
effective search space: 182095182630
effective search space used: 182095182630
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)