BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2441114.2.1
(964 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AA556201.1|AA556201 56 Loblolly pine N Pinus taeda cDNA ... 52 4e-005
gb|AW290319.1|AW290319 NXNV018H02F Nsf Xylem Normal wood Ve... 52 4e-005
gb|BE187399.1|BE187399 NXNV_163_E05_F Nsf Xylem Normal wood... 52 4e-005
gb|BE496546.1|BE496546 NXCI_020_E01_F NXCI (Nsf Xylem Compr... 52 4e-005
gb|BE997092.1|BE997092 NXCI_098_H03_F NXCI (Nsf Xylem Compr... 52 4e-005
gb|BE997194.1|BE997194 NXCI_107_E09_F NXCI (Nsf Xylem Compr... 52 4e-005
gb|BF169692.1|BF169692 NXCI_126_E11_F NXCI (Nsf Xylem Compr... 52 4e-005
gb|BF186159.1|BF186159 NXCI_133_F09_F NXCI (Nsf Xylem Compr... 52 4e-005
gb|BF517818.1|BF517818 NXSI_027_E10_F NXSI (Nsf Xylem Side ... 52 4e-005
gb|BF609503.1|BF609503 NXSI_043_D07_F NXSI (Nsf Xylem Side ... 52 4e-005
gb|BG039184.1|BG039184 NXSI_095_H09_F NXSI (Nsf Xylem Side ... 52 4e-005
gb|BG040940.1|BG040940 NXSI_116_H05_F NXSI (Nsf Xylem Side ... 52 4e-005
gb|BG318371.1|BG318371 NXPV_012_G12_F NXPV (Nsf Xylem Plani... 52 4e-005
gb|BG673842.1|BG673842 NXPV_075_G09_F NXPV (Nsf Xylem Plani... 52 4e-005
gb|BQ290492.1|BQ290492 NXRV045_A02_F NXRV (Nsf Xylem Root w... 52 4e-005
gb|BQ634173.1|BQ634173 NXRV064_F07_F NXRV (Nsf Xylem Root w... 52 4e-005
gb|BQ634407.1|BQ634407 NXRV068_E11_F NXRV (Nsf Xylem Root w... 52 4e-005
gb|BQ635039.1|BQ635039 NXRV076_B12_F NXRV (Nsf Xylem Root w... 52 4e-005
gb|BQ635286.1|BQ635286 NXRV078_E01_F NXRV (Nsf Xylem Root w... 52 4e-005
gb|BQ654945.1|BQ654945 NXRV088_B04_F NXRV (Nsf Xylem Root w... 52 4e-005
gb|BQ655122.1|BQ655122 NXRV090_E04_F NXRV (Nsf Xylem Root w... 52 4e-005
gb|BQ696917.1|BQ696917 NXPV_046_H01_F NXPV (Nsf Xylem Plani... 52 4e-005
gb|BQ697148.1|BQ697148 NXPV_050_B04_F NXPV (Nsf Xylem Plani... 52 4e-005
gb|BQ698779.1|BQ698779 NXNV_063_F12_F Nsf Xylem Normal wood... 52 4e-005
gb|BQ699513.1|BQ699513 NXRV123_C07_F NXRV (Nsf Xylem Root w... 52 4e-005
gb|CD027018.1|CD027018 NXNV018H02 Nsf Xylem Normal wood Ver... 52 4e-005
gb|CF394113.1|CF394113 RTDS2_3_F06.g1_A021 Drought-stressed... 52 4e-005
gb|CF474390.1|CF474390 RTWW2_20_E12.g1_A021 Well-watered lo... 52 4e-005
gb|CF666108.1|CF666108 RTCNT1_20_G08.g1_A029 Root control P... 52 4e-005
gb|CO160267.1|CO160267 FLD1_19_G10.g1_A029 Root flooded Pin... 52 4e-005
gb|CO167577.1|CO167577 FLD1_69_F12.g1_A029 Root flooded Pin... 52 4e-005
gb|CV033679.1|CV033679 RTNACL1_36_A12.b1_A029 Roots plus ad... 52 4e-005
gb|CV034548.1|CV034548 RTNACL1_9_G12.g1_A029 Roots plus add... 52 4e-005
gb|CV034763.1|CV034763 RTNACL1_11_A07.g1_A029 Roots plus ad... 52 4e-005
gb|CX651490.1|CX651490 COLD1_52_F06.g1_A029 Root cold Pinus... 52 4e-005
gb|CX713194.1|CX713194 RTPQ1_7_C08.g1_A032 Roots treated wi... 52 4e-005
gb|DR072705.1|DR072705 RTDK1_28_C05.b1_A029 Roots, dark Pin... 52 4e-005
gb|DR089798.1|DR089798 RTAL1_10_H02.g1_A029 Roots plus adde... 52 4e-005
gb|DR161948.1|DR161948 RTFE1_14_G12.g1_A029 Roots minus iro... 52 4e-005
gb|BE187094.1|BE187094 NXNV_155_E07_F Nsf Xylem Normal wood... 50 2e-004
gb|BQ634093.1|BQ634093 NXRV065_F12_F NXRV (Nsf Xylem Root w... 50 2e-004
gb|BQ699915.1|BQ699915 NXRV131_D02_F NXRV (Nsf Xylem Root w... 50 2e-004
gb|BQ290612.1|BQ290612 NXRV047_E02_F NXRV (Nsf Xylem Root w... 48 7e-004
gb|BQ291138.1|BQ291138 NXRV056_C07_F NXRV (Nsf Xylem Root w... 48 7e-004
gb|BQ291200.1|BQ291200 NXRV057_B07_F NXRV (Nsf Xylem Root w... 48 7e-004
gb|BQ291343.1|BQ291343 NXRV052_A02_F NXRV (Nsf Xylem Root w... 48 7e-004
gb|CD024298.1|CD024298 NXRV_039_E03_F NXRV (Nsf Xylem Root ... 48 7e-004
gb|CD025371.1|CD025371 NXSI_048_C03_F NXSI (Nsf Xylem Side ... 48 7e-004
gb|CX648457.1|CX648457 COLD1_28_F07.g1_A029 Root cold Pinus... 48 7e-004
gb|CX652128.1|CX652128 COLD1_57_C12.b1_A029 Root cold Pinus... 48 7e-004
gb|DR161658.1|DR161658 RTFE1_13_D07.b1_A029 Roots minus iro... 48 7e-004
gb|BX249487.1|BX249487 BX249487 Pinus pinaster differenciat... 46 0.003
gb|BX249528.1|BX249528 BX249528 Pinus pinaster differenciat... 46 0.003
gb|BX250113.1|BX250113 BX250113 Pinus pinaster differenciat... 46 0.003
gb|BX251987.1|BX251987 BX251987 Pinus pinaster differenciat... 46 0.003
gb|BX254495.1|BX254495 BX254495 Pinus pinaster differenciat... 46 0.003
gb|BE187183.1|BE187183 NXNV_160_C07_F Nsf Xylem Normal wood... 46 0.003
gb|BQ699015.1|BQ699015 NXRV118_D04_F NXRV (Nsf Xylem Root w... 46 0.003
gb|BQ699628.1|BQ699628 NXRV124_G04_F NXRV (Nsf Xylem Root w... 46 0.003
gb|CD024432.1|CD024432 NXRV_041_B09_F NXRV (Nsf Xylem Root ... 46 0.003
gb|CD024510.1|CD024510 NXRV_043_H09_F NXRV (Nsf Xylem Root ... 46 0.003
gb|CF395771.1|CF395771 RTDS2_17_H10.g1_A021 Drought-stresse... 46 0.003
gb|BX680292.1|BX680292 BX680292 RS Pinus pinaster cDNA clon... 46 0.003
gb|CO199601.1|CO199601 GEO2_2_G09.b1_A032 Root gravitropism... 46 0.003
gb|CO199683.1|CO199683 GEO2_2_G09.g1_A032 Root gravitropism... 46 0.003
gb|CV032747.1|CV032747 RTNACL1_18_C09.b1_A029 Roots plus ad... 46 0.003
gb|CV032828.1|CV032828 RTNACL1_18_C09.g1_A029 Roots plus ad... 46 0.003
gb|CX645608.1|CX645608 COLD1_4_C01.b1_A029 Root cold Pinus ... 46 0.003
gb|CX651912.1|CX651912 COLD1_55_D09.g1_A029 Root cold Pinus... 46 0.003
gb|CX712703.1|CX712703 RTPQ1_4_E07.b2_A032 Roots treated wi... 46 0.003
gb|CX712776.1|CX712776 RTPQ1_4_E07.g2_A032 Roots treated wi... 46 0.003
gb|DR011080.1|DR011080 HEAT1_3_F11.b1_A029 Root at 37 C for... 46 0.003
gb|DR072297.1|DR072297 RTDK1_25_G09.b1_A029 Roots, dark Pin... 46 0.003
gb|DR072370.1|DR072370 RTDK1_25_G09.g1_A029 Roots, dark Pin... 46 0.003
gb|DR080208.1|DR080208 RTFEPL1_21_D02.b1_A029 Roots plus ad... 46 0.003
gb|DR080281.1|DR080281 RTFEPL1_21_D02.g1_A029 Roots plus ad... 46 0.003
gb|DR088770.1|DR088770 RTAL1_4_A02.g1_A029 Roots plus added... 46 0.003
gb|DR178487.1|DR178487 RTMNUT1_12_D04.b1_A029 Roots minus m... 46 0.003
gb|DR688820.1|DR688820 EST1078906 Normalized pine embryo li... 46 0.003
gb|DR689054.1|DR689054 EST1079140 Normalized pine embryo li... 46 0.003
gb|DR743028.1|DR743028 RTCU1_13_C09.b1_A029 Roots plus adde... 46 0.003
gb|DR743104.1|DR743104 RTCU1_13_C09.g1_A029 Roots plus adde... 46 0.003
gb|DT635057.1|DT635057 EST1149988 Normalized pine embryo li... 46 0.003
gb|DT635315.1|DT635315 EST1150246 Normalized pine embryo li... 46 0.003
gb|AW056708.1|AW056708 ST54G10 Pine TriplEx shoot tip libra... 44 0.011
gb|AW495767.1|AW495767 NXNV_065_B06_FF Nsf Xylem Normal woo... 44 0.011
gb|BX249905.1|BX249905 BX249905 Pinus pinaster differenciat... 44 0.011
gb|BX249948.1|BX249948 BX249948 Pinus pinaster differenciat... 44 0.011
gb|BX250551.1|BX250551 BX250551 Pinus pinaster differenciat... 44 0.011
gb|BX250709.1|BX250709 BX250709 Pinus pinaster differenciat... 44 0.011
gb|BX251160.1|BX251160 BX251160 Pinus pinaster differenciat... 44 0.011
gb|BX254123.1|BX254123 BX254123 Pinus pinaster differenciat... 44 0.011
gb|BX254234.1|BX254234 BX254234 Pinus pinaster differenciat... 44 0.011
gb|BX255214.1|BX255214 BX255214 Pinus pinaster differenciat... 44 0.011
gb|BX255628.1|BX255628 BX255628 Pinus pinaster differenciat... 44 0.011
gb|AW870091.1|AW870091 NXNV_124_A03_F Nsf Xylem Normal wood... 44 0.011
gb|BE758680.1|BE758680 NXCI_062_A10_F NXCI (Nsf Xylem Compr... 44 0.011
gb|BF517905.1|BF517905 NXSI_031_E03_F NXSI (Nsf Xylem Side ... 44 0.011
gb|BF517971.1|BF517971 NXSI_032_C09_F NXSI (Nsf Xylem Side ... 44 0.011
gb|BF518306.1|BF518306 NXSI_037_G04_F NXSI (Nsf Xylem Side ... 44 0.011
gb|BF610028.1|BF610028 NXSI_053_H09_F NXSI (Nsf Xylem Side ... 44 0.011
gb|BF777196.1|BF777196 NXSI_066_D03_F NXSI (Nsf Xylem Side ... 44 0.011
gb|BG318207.1|BG318207 NXPV_011_G11_F NXPV (Nsf Xylem Plani... 44 0.011
gb|BG673782.1|BG673782 NXPV_075_A05_F NXPV (Nsf Xylem Plani... 44 0.011
gb|BQ290463.1|BQ290463 NXRV046_E10_F NXRV (Nsf Xylem Root w... 44 0.011
gb|BQ634877.1|BQ634877 NXRV074_C05_F NXRV (Nsf Xylem Root w... 44 0.011
gb|CD022220.1|CD022220 NXPV_027_D11_F NXPV (Nsf Xylem Plani... 44 0.011
gb|CD027724.1|CD027724 NXNV_065_B06_F Nsf Xylem Normal wood... 44 0.011
gb|CF390682.1|CF390682 RTDR2_20_B08.g1_A021 Loblolly pine r... 44 0.011
gb|CF391064.1|CF391064 RTDR3_3_F10.g1_A022 Loblolly pine ro... 44 0.011
gb|CF394084.1|CF394084 RTDS2_3_F06.b1_A021 Drought-stressed... 44 0.011
gb|CF402335.1|CF402335 RTWW1_19_A04.g1_A015 Well-watered lo... 44 0.011
gb|CF665368.1|CF665368 RTCNT1_15_C07.g1_A029 Root control P... 44 0.011
gb|CF669680.1|CF669680 RTCNT1_45_A03.g1_A029 Root control P... 44 0.011
gb|CF671413.1|CF671413 RTCNT1_56_H12.g1_A029 Root control P... 44 0.011
gb|CR392417.1|CR392417 CR392417 RN Pinus pinaster cDNA clon... 44 0.011
gb|CR392735.1|CR392735 CR392735 RN Pinus pinaster cDNA clon... 44 0.011
gb|CO160190.1|CO160190 FLD1_19_G10.b1_A029 Root flooded Pin... 44 0.011
gb|CO164625.1|CO164625 FLD1_49_F04.b1_A029 Root flooded Pin... 44 0.011
gb|CV032710.1|CV032710 RTNACL1_17_H04.g1_A029 Roots plus ad... 44 0.011
gb|CV033276.1|CV033276 RTNACL1_33_B07.g1_A029 Roots plus ad... 44 0.011
gb|CV034492.1|CV034492 RTNACL1_9_G12.b1_A029 Roots plus add... 44 0.011
gb|CV034693.1|CV034693 RTNACL1_11_A07.b1_A029 Roots plus ad... 44 0.011
gb|CX645821.1|CX645821 COLD1_5_B07.g1_A029 Root cold Pinus ... 44 0.011
gb|CX648374.1|CX648374 COLD1_28_F07.b1_A029 Root cold Pinus... 44 0.011
gb|CX713113.1|CX713113 RTPQ1_7_C08.b1_A032 Roots treated wi... 44 0.011
gb|CX714768.1|CX714768 RTPQ1_26_D02.g1_A032 Roots treated w... 44 0.011
gb|DR013225.1|DR013225 HEAT1_18_A08.b1_A029 Root at 37 C fo... 44 0.011
gb|DR013301.1|DR013301 HEAT1_18_A08.g1_A029 Root at 37 C fo... 44 0.011
gb|DR014701.1|DR014701 HEAT1_51_C10.b1_A029 Root at 37 C fo... 44 0.011
gb|DR048281.1|DR048281 RTBOR1_7_E09.g2_A029 Roots plus adde... 44 0.011
gb|DR052331.1|DR052331 RTCA1_4_A04.b1_A029 Roots minus calc... 44 0.011
gb|DR052406.1|DR052406 RTCA1_4_A04.g1_A029 Roots minus calc... 44 0.011
gb|DR053482.1|DR053482 RTCA1_11_A06.g1_A029 Roots minus cal... 44 0.011
gb|DR061030.1|DR061030 RTNIT1_31_D05.g1_A029 Roots minus ni... 44 0.011
gb|DR080650.1|DR080650 RTFEPL1_24_E09.b1_A029 Roots plus ad... 44 0.011
gb|DR080719.1|DR080719 RTFEPL1_24_E09.g1_A029 Roots plus ad... 44 0.011
gb|DR089712.1|DR089712 RTAL1_10_H02.b1_A029 Roots plus adde... 44 0.011
gb|DR094647.1|DR094647 STRR1_15_H01.g1_A033 Stem Response R... 44 0.011
gb|DR097195.1|DR097195 STRR1_33_D11.b1_A033 Stem Response R... 44 0.011
gb|DR112815.1|DR112815 RTS1_30_G06.g1_A029 Roots minus sulf... 44 0.011
gb|DR118662.1|DR118662 RTMG1_18_A05.g1_A029 Roots minus mag... 44 0.011
gb|DR120320.1|DR120320 RTMG1_29_A02.b1_A029 Roots minus mag... 44 0.011
gb|DR120392.1|DR120392 RTMG1_29_A02.g1_A029 Roots minus mag... 44 0.011
gb|DR120648.1|DR120648 RTMG1_31_C06.b1_A029 Roots minus mag... 44 0.011
gb|DR161306.1|DR161306 RTFE1_11_B11.b1_A029 Roots minus iro... 44 0.011
gb|DR161390.1|DR161390 RTFE1_11_B11.g1_A029 Roots minus iro... 44 0.011
gb|DR161860.1|DR161860 RTFE1_14_G12.b1_A029 Roots minus iro... 44 0.011
gb|DR179632.1|DR179632 RTMNUT1_23_G11.b2_A029 Roots minus m... 44 0.011
gb|DR744558.1|DR744558 RTCU1_23_F12.b1_A029 Roots plus adde... 44 0.011
gb|DR744628.1|DR744628 RTCU1_23_F12.g1_A029 Roots plus adde... 44 0.011
gb|DR745650.1|DR745650 RTCU1_31_H08.b1_A029 Roots plus adde... 44 0.011
gb|AW289699.1|AW289699 NXNV004C12F Nsf Xylem Normal wood Ve... 40 0.16
gb|AW698117.1|AW698117 NXNV_066_F09_F Nsf Xylem Normal wood... 40 0.16
gb|BQ699992.1|BQ699992 NXRV132_F11_F NXRV (Nsf Xylem Root w... 40 0.16
gb|CD028249.1|CD028249 NXNV004C12 Nsf Xylem Normal wood Ver... 40 0.16
gb|CO174938.1|CO174938 NDL1_47_F08.b1_A029 Needles control ... 40 0.16
gb|CO175015.1|CO175015 NDL1_47_F08.g1_A029 Needles control ... 40 0.16
gb|DR053681.1|DR053681 RTCA1_12_E02.g1_A029 Roots minus cal... 40 0.16
gb|DR163468.1|DR163468 RTFE1_43_C11.b1_A029 Roots minus iro... 40 0.16
gb|DR163556.1|DR163556 RTFE1_43_C11.g1_A029 Roots minus iro... 40 0.16
gb|DR689576.1|DR689576 EST1079662 Normalized pine embryo li... 40 0.16
gb|DT635563.1|DT635563 EST1150494 Normalized pine embryo li... 40 0.16
>gb|AA556201.1|AA556201 56 Loblolly pine N Pinus taeda cDNA clone 2N8C, mRNA sequence
Length = 470
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 44 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 103
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 104 tgaggagattaaaaaagg 121
>gb|AW290319.1|AW290319 NXNV018H02F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV018H02 5', mRNA sequence
Length = 522
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 52 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 111
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 112 tgaggagattaaaaaagg 129
>gb|BE187399.1|BE187399 NXNV_163_E05_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_163_E05 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 491
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 52 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 111
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 112 tgaggagattaaaaaagg 129
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 299 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 348
>gb|BE496546.1|BE496546 NXCI_020_E01_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_020_E01 5' similar to Arabidopsis
thaliana sequence At5g54500 1,4-benzoquinone
reductase-like; Trp repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 545
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 52 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 111
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 112 tgaggagattaaaaaagg 129
>gb|BE997092.1|BE997092 NXCI_098_H03_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_098_H03 5' similar to Arabidopsis
thaliana sequence At5g54500 1,4-benzoquinone
reductase-like; Trp repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 435
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 44 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 103
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 104 tgaggagattaaaaaagg 121
>gb|BE997194.1|BE997194 NXCI_107_E09_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_107_E09 5' similar to Arabidopsis
thaliana sequence At5g54500 1,4-benzoquinone
reductase-like; Trp repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 443
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 44 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 103
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 104 tgaggagattaaaaaagg 121
>gb|BF169692.1|BF169692 NXCI_126_E11_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_126_E11 5' similar to Arabidopsis
thaliana sequence At5g54500 1,4-benzoquinone
reductase-like; Trp repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 302
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 55 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 114
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 115 tgaggagattaaaaaagg 132
>gb|BF186159.1|BF186159 NXCI_133_F09_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_133_F09 5' similar to Arabidopsis
thaliana sequence At5g54500 1,4-benzoquinone
reductase-like; Trp repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 478
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 55 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 114
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 115 tgaggagattaaaaaagg 132
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 302 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 351
>gb|BF517818.1|BF517818 NXSI_027_E10_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_027_E10 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 367
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 50 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 109
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 110 tgaggagattaaaaaagg 127
>gb|BF609503.1|BF609503 NXSI_043_D07_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_043_D07 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 434
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 48 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 107
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 108 tgaggagattaaaaaagg 125
>gb|BG039184.1|BG039184 NXSI_095_H09_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_095_H09 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 494
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 52 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 111
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 112 tgaggagattaaaaaagg 129
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 299 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 348
>gb|BG040940.1|BG040940 NXSI_116_H05_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_116_H05 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 548
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 52 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 111
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 112 tgaggagattaaaaaagg 129
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 299 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 348
>gb|BG318371.1|BG318371 NXPV_012_G12_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_012_G12 5' similar to Arabidopsis
thaliana sequence At5g54500 1,4-benzoquinone
reductase-like; Trp repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 324
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 61 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 120
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 121 tgaggagattaaaaaagg 138
>gb|BG673842.1|BG673842 NXPV_075_G09_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_075_G09 5' similar to Arabidopsis
thaliana sequence At5g54500 1,4-benzoquinone
reductase-like; Trp repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 504
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 61 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 120
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 121 tgaggagattaaaaaagg 138
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 308 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 357
>gb|BQ290492.1|BQ290492 NXRV045_A02_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV045_A02 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 570
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 61 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 120
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 121 tgaggagattaaaaaagg 138
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 308 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 357
>gb|BQ634173.1|BQ634173 NXRV064_F07_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV064_F07 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 734
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 59 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 118
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 119 tgaggagattaaaaaagg 136
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 306 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 355
>gb|BQ634407.1|BQ634407 NXRV068_E11_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV068_E11 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 564
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 61 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 120
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 121 tgaggagattaaaaaagg 138
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 308 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 357
>gb|BQ635039.1|BQ635039 NXRV076_B12_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV076_B12 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 555
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 65 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 124
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 125 tgaggagattaaaaaagg 142
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 312 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 361
>gb|BQ635286.1|BQ635286 NXRV078_E01_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV078_E01 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 325
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 43 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 102
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 103 tgaggagattaaaaaagg 120
>gb|BQ654945.1|BQ654945 NXRV088_B04_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV088_B04 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 430
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 56 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 115
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 116 tgaggagattaaaaaagg 133
>gb|BQ655122.1|BQ655122 NXRV090_E04_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV090_E04 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 734
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 36 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 95
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 96 tgaggagattaaaaaagg 113
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 283 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 332
>gb|BQ696917.1|BQ696917 NXPV_046_H01_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_046_H01 5' similar to Arabidopsis
thaliana sequence At5g54500 1,4-benzoquinone
reductase-like; Trp repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 542
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 61 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 120
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 121 tgaggagattaaaaaagg 138
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 308 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 357
>gb|BQ697148.1|BQ697148 NXPV_050_B04_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_050_B04 5' similar to Arabidopsis
thaliana sequence At5g54500 1,4-benzoquinone
reductase-like; Trp repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 531
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 61 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 120
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 121 tgaggagattaaaaaagg 138
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 308 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 357
>gb|BQ698779.1|BQ698779 NXNV_063_F12_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_063_F12 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 247
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 52 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 111
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 112 tgaggagattaaaaaagg 129
>gb|BQ699513.1|BQ699513 NXRV123_C07_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV123_C07 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 468
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 56 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 115
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 116 tgaggagattaaaaaagg 133
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 305 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 354
>gb|CD027018.1|CD027018 NXNV018H02 Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV018H02 5' similar to Arabidopsis thaliana sequence
At5g54500 1,4-benzoquinone reductase-like; Trp repressor
binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 522
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 52 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 111
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 112 tgaggagattaaaaaagg 129
Score = 40.1 bits (20), Expect = 0.16
Identities = 42/50 (84%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| || || ||||| ||||| || ||||||||
Sbjct: 299 ggaatgatggcagctcagtnnaaagctttcttggatgcaacaggtgggct 348
>gb|CF394113.1|CF394113 RTDS2_3_F06.g1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_3_F06_A021 5', mRNA sequence
Length = 791
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 58 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 117
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 118 tgaggagattaaaaaagg 135
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 305 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 354
>gb|CF474390.1|CF474390 RTWW2_20_E12.g1_A021 Well-watered loblolly pine roots WW2 Pinus
taeda cDNA clone RTWW2_20_E12_A021 5', mRNA sequence
Length = 717
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 8 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 67
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 68 tgaggagattaaaaaagg 85
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 255 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 304
>gb|CF666108.1|CF666108 RTCNT1_20_G08.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_20_G08_A029 5', mRNA sequence
Length = 588
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 3 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 62
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 63 tgaggagattaaaaaagg 80
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 250 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 299
>gb|CO160267.1|CO160267 FLD1_19_G10.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_19_G10_A029 5', mRNA sequence
Length = 807
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 55 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 114
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 115 tgaggagattaaaaaagg 132
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 302 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 351
>gb|CO167577.1|CO167577 FLD1_69_F12.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_69_F12_A029 5', mRNA sequence
Length = 828
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 41 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 100
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 101 tgaggagattaaaaaagg 118
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 288 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 337
>gb|CV033679.1|CV033679 RTNACL1_36_A12.b1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_36_A12_A029 3', mRNA sequence
Length = 828
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Minus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 785 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 726
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 725 tgaggagattaaaaaagg 708
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 538 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 489
>gb|CV034548.1|CV034548 RTNACL1_9_G12.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_9_G12_A029 5', mRNA sequence
Length = 768
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 35 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 94
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 95 tgaggagattaaaaaagg 112
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 282 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 331
>gb|CV034763.1|CV034763 RTNACL1_11_A07.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_11_A07_A029 5', mRNA sequence
Length = 721
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 29 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 88
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 89 tgaggagattaaaaaagg 106
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 276 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 325
>gb|CX651490.1|CX651490 COLD1_52_F06.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_52_F06_A029 5', mRNA sequence
Length = 572
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 41 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 100
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 101 tgaggagattaaaaaagg 118
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 288 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 337
>gb|CX713194.1|CX713194 RTPQ1_7_C08.g1_A032 Roots treated with paraquat Pinus taeda cDNA
clone RTPQ1_7_C08_A032 5', mRNA sequence
Length = 816
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 54 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 113
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 114 tgaggagattaaaaaagg 131
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 301 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 350
>gb|DR072705.1|DR072705 RTDK1_28_C05.b1_A029 Roots, dark Pinus taeda cDNA clone
RTDK1_28_C05_A029 3', mRNA sequence
Length = 719
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Minus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 685 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 626
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 625 tgaggagattaaaaaagg 608
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 438 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 389
>gb|DR089798.1|DR089798 RTAL1_10_H02.g1_A029 Roots plus added aluminum Pinus taeda cDNA
clone RTAL1_10_H02_A029 5', mRNA sequence
Length = 738
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 65 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 124
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 125 tgaggagattaaaaaagg 142
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 312 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 361
>gb|DR161948.1|DR161948 RTFE1_14_G12.g1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_14_G12_A029 5', mRNA sequence
Length = 492
Score = 52.0 bits (26), Expect = 4e-005
Identities = 65/78 (83%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 42 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 101
Query: 180 tgacgagatcaagaaagg 197
||| ||||| || |||||
Sbjct: 102 tgaggagattaaaaaagg 119
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 289 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 338
>gb|BE187094.1|BE187094 NXNV_155_E07_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_155_E07 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 275
Score = 50.1 bits (25), Expect = 2e-004
Identities = 58/69 (84%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 59 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 118
Query: 180 tgacgagat 188
||| |||||
Sbjct: 119 tgaggagat 127
>gb|BQ634093.1|BQ634093 NXRV065_F12_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV065_F12 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 543
Score = 50.1 bits (25), Expect = 2e-004
Identities = 58/69 (84%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 38 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 97
Query: 180 tgacgagat 188
||| |||||
Sbjct: 98 tgaggagat 106
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 284 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 333
>gb|BQ699915.1|BQ699915 NXRV131_D02_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV131_D02 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 545
Score = 50.1 bits (25), Expect = 2e-004
Identities = 58/69 (84%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgttggcaaactagc 179
|||||| || ||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||
Sbjct: 36 aatggctgtcaagatttacattgtgttctattccatgtatggacatgtagagaaacttgc 95
Query: 180 tgacgagat 188
||| |||||
Sbjct: 96 tgaggagat 104
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 282 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 331
>gb|BQ290612.1|BQ290612 NXRV047_E02_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV047_E02 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 740
Score = 48.1 bits (24), Expect = 7e-004
Identities = 57/68 (83%)
Strand = Plus / Plus
Query: 130 aagatctacgttgtgtactattccatgtatgggcatgttggcaaactagctgacgagatc 189
||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||||| |||||
Sbjct: 74 aagatttacattgtgttctattccatgtatggacatgtagagaaacttgctgaggagatt 133
Query: 190 aagaaagg 197
|| |||||
Sbjct: 134 aaaaaagg 141
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 311 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 360
>gb|BQ291138.1|BQ291138 NXRV056_C07_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV056_C07 5' similar to Arabidopsis thaliana
sequence At4g27270 putative protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 701
Score = 48.1 bits (24), Expect = 7e-004
Identities = 57/68 (83%)
Strand = Plus / Plus
Query: 130 aagatctacgttgtgtactattccatgtatgggcatgttggcaaactagctgacgagatc 189
||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||||| |||||
Sbjct: 74 aagatttacattgtgttctattccatgtatggacatgtagagaaacttgctgaggagatt 133
Query: 190 aagaaagg 197
|| |||||
Sbjct: 134 aaaaaagg 141
Score = 40.1 bits (20), Expect = 0.16
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagat 386
||||||||||||||||||||
Sbjct: 311 ggaatgatggcagctcagat 330
>gb|BQ291200.1|BQ291200 NXRV057_B07_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV057_B07 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 662
Score = 48.1 bits (24), Expect = 7e-004
Identities = 57/68 (83%)
Strand = Plus / Plus
Query: 130 aagatctacgttgtgtactattccatgtatgggcatgttggcaaactagctgacgagatc 189
||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||||| |||||
Sbjct: 74 aagatttacattgtgttctattccatgtatggacatgtagagaaacttgctgaggagatt 133
Query: 190 aagaaagg 197
|| |||||
Sbjct: 134 aaaaaagg 141
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 311 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 360
>gb|BQ291343.1|BQ291343 NXRV052_A02_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV052_A02 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 552
Score = 48.1 bits (24), Expect = 7e-004
Identities = 57/68 (83%)
Strand = Plus / Plus
Query: 130 aagatctacgttgtgtactattccatgtatgggcatgttggcaaactagctgacgagatc 189
||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||||| |||||
Sbjct: 73 aagatttacattgtgttctattccatgtatggacatgtagagaaacttgctgaggagatt 132
Query: 190 aagaaagg 197
|| |||||
Sbjct: 133 aaaaaagg 140
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 310 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 359
>gb|CD024298.1|CD024298 NXRV_039_E03_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV_039_E03 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 151
Score = 48.1 bits (24), Expect = 7e-004
Identities = 42/48 (87%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgt 167
|||||| || ||||| ||| |||||| ||||||||||||||| |||||
Sbjct: 61 aatggctgtcaagatttacattgtgttctattccatgtatggacatgt 108
>gb|CD025371.1|CD025371 NXSI_048_C03_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_048_C03 5' similar to Arabidopsis thaliana
sequence At5g54500 1,4-benzoquinone reductase-like; Trp
repressor binding protein-like see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 178
Score = 48.1 bits (24), Expect = 7e-004
Identities = 42/48 (87%)
Strand = Plus / Plus
Query: 120 aatggcggttaagatctacgttgtgtactattccatgtatgggcatgt 167
|||||| || ||||| ||| |||||| ||||||||||||||| |||||
Sbjct: 61 aatggctgtcaagatttacattgtgttctattccatgtatggacatgt 108
>gb|CX648457.1|CX648457 COLD1_28_F07.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_28_F07_A029 5', mRNA sequence
Length = 781
Score = 48.1 bits (24), Expect = 7e-004
Identities = 57/68 (83%)
Strand = Plus / Plus
Query: 130 aagatctacgttgtgtactattccatgtatgggcatgttggcaaactagctgacgagatc 189
||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||||| |||||
Sbjct: 20 aagatttacattgtgttctattccatgtatggacatgtagagaaacttgctgaggagatt 79
Query: 190 aagaaagg 197
|| |||||
Sbjct: 80 aaaaaagg 87
Score = 44.1 bits (22), Expect = 0.011
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 367 ggaatgatggcagctcagatgaaggcgttcttcgatgccaccggtgggct 416
|||||||||||||||||| | || || ||||| ||||| || ||||||||
Sbjct: 257 ggaatgatggcagctcagtttaaagctttcttggatgcaacaggtgggct 306
>gb|CX652128.1|CX652128 COLD1_57_C12.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_57_C12_A029 3', mRNA sequence
Length = 254
Score = 48.1 bits (24), Expect = 7e-004
Identities = 57/68 (83%)
Strand = Plus / Minus
Query: 130 aagatctacgttgtgtactattccatgtatgggcatgttggcaaactagctgacgagatc 189
||||| ||| |||||| ||||||||||||||| ||||| | ||||| ||||| |||||
Sbjct: 186 aagatttacattgtgttctattccatgtatggacatgtagagaaacttgctgaggagatt 127
Query: 190 aagaaagg 197
|| |||||
Sbjct: 126 aaaaaagg 119
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 99,882
Number of Sequences: 355925
Number of extensions: 99882
Number of successful extensions: 26038
Number of sequences better than 0.5: 166
Number of HSP's better than 0.5 without gapping: 166
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25731
Number of HSP's gapped (non-prelim): 307
length of query: 964
length of database: 217,277,237
effective HSP length: 19
effective length of query: 945
effective length of database: 210,514,662
effective search space: 198936355590
effective search space used: 198936355590
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)