BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2441058.2.1
         (1000 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CX713426.1|CX713426  RTPQ1_9_D07.b1_A032 Roots treated wi...    56   3e-006
gb|BM133196.1|BM133196  NXLV_001_E01_F NXLV (Nsf Xylem Late ...    54   1e-005

>gb|CX713426.1|CX713426 RTPQ1_9_D07.b1_A032 Roots treated with paraquat Pinus taeda cDNA
           clone RTPQ1_9_D07_A032 3', mRNA sequence
          Length = 479

 Score = 56.0 bits (28), Expect = 3e-006
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 625 aaacttggcattactattcttggtgaagccgttgatgttgaagatgaagtagttgt 680
           |||||||| ||||| ||||||||||| | |||   |||||||||||||||||||||
Sbjct: 147 aaacttggaattacaattcttggtgaggacgtgactgttgaagatgaagtagttgt 202



>gb|BM133196.1|BM133196 NXLV_001_E01_F NXLV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA
           clone NXLV_001_E01 5' similar to Arabidopsis thaliana
           sequence At1g74910 putative GDP-mannose
           pyrophosphorylase see
           http://mips.gsf.de/proj/thal/db/index.html, mRNA
           sequence
          Length = 451

 Score = 54.0 bits (27), Expect = 1e-005
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 625 aaacttggcattactattcttggtgaagccgttgatgttgaagatgaagtagttg 679
           |||||||| ||||| ||||||||||| | |||   ||||||||||||||||||||
Sbjct: 112 aaacttggaattacaattcttggtgaggacgtgactgttgaagatgaagtagttg 166



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 115,775
Number of Sequences: 355925
Number of extensions: 115775
Number of successful extensions: 30226
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 30223
Number of HSP's gapped (non-prelim): 3
length of query: 1000
length of database: 217,277,237
effective HSP length: 19
effective length of query: 981
effective length of database: 210,514,662
effective search space: 206514883422
effective search space used: 206514883422
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)