BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2419417.2.5
(733 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CX646890.1|CX646890 COLD1_12_D12.b1_A029 Root cold Pinus... 74 9e-012
gb|CX646974.1|CX646974 COLD1_12_D12.g1_A029 Root cold Pinus... 74 9e-012
gb|BG318466.1|BG318466 NXPV_013_H10_F NXPV (Nsf Xylem Plani... 56 2e-006
gb|BQ695893.1|BQ695893 NXPV_033_H04_F NXPV (Nsf Xylem Plani... 56 2e-006
gb|BQ696465.1|BQ696465 NXPV_041_F02_F NXPV (Nsf Xylem Plani... 56 2e-006
gb|BQ697291.1|BQ697291 NXPV_055_C02_F NXPV (Nsf Xylem Plani... 56 2e-006
gb|CO162557.1|CO162557 FLD1_36_C02.b1_A029 Root flooded Pin... 56 2e-006
gb|CO164776.1|CO164776 FLD1_50_F04.b1_A029 Root flooded Pin... 56 2e-006
gb|DR019869.1|DR019869 STRS1_33_B04.b1_A034 Shoot tip pitch... 56 2e-006
>gb|CX646890.1|CX646890 COLD1_12_D12.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_12_D12_A029 3', mRNA sequence
Length = 777
Score = 73.8 bits (37), Expect = 9e-012
Identities = 73/85 (85%)
Strand = Plus / Plus
Query: 200 gggtacttcgcgtggtcgttgctggacaactgggaatgggccgccgggtacacctccaga 259
||||| || |||||||| || ||||||| ||||||||||| || |||||||| ||||||
Sbjct: 182 gggtattttgcgtggtctctgttggacaattgggaatgggcagcggggtacacatccaga 241
Query: 260 ttcgggctctacttcgtggactaca 284
|| |||||||| ||||| |||||||
Sbjct: 242 tttgggctctatttcgttgactaca 266
>gb|CX646974.1|CX646974 COLD1_12_D12.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_12_D12_A029 5', mRNA sequence
Length = 794
Score = 73.8 bits (37), Expect = 9e-012
Identities = 73/85 (85%)
Strand = Plus / Plus
Query: 200 gggtacttcgcgtggtcgttgctggacaactgggaatgggccgccgggtacacctccaga 259
||||| || |||||||| || ||||||| ||||||||||| || |||||||| ||||||
Sbjct: 247 gggtattttgcgtggtctctgttggacaattgggaatgggcagcggggtacacatccaga 306
Query: 260 ttcgggctctacttcgtggactaca 284
|| |||||||| ||||| |||||||
Sbjct: 307 tttgggctctatttcgttgactaca 331
>gb|BG318466.1|BG318466 NXPV_013_H10_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_013_H10 5' similar to Arabidopsis
thaliana sequence At1g26560 beta-glucosidase like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 449
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 230 tgggaatgggccgccgggtacacctccagattcgggctctacttcgtggactacaa 285
||||||||||| || |||||||| |||||||| |||||||| || || ||||||||
Sbjct: 190 tgggaatgggcagcagggtacacttccagatttgggctctattttgttgactacaa 245
>gb|BQ695893.1|BQ695893 NXPV_033_H04_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_033_H04 5' similar to Arabidopsis
thaliana sequence At1g26560 beta-glucosidase like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 449
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 230 tgggaatgggccgccgggtacacctccagattcgggctctacttcgtggactacaa 285
||||||||||| || |||||||| |||||||| |||||||| || || ||||||||
Sbjct: 190 tgggaatgggcagcagggtacacttccagatttgggctctattttgttgactacaa 245
>gb|BQ696465.1|BQ696465 NXPV_041_F02_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_041_F02 5' similar to Arabidopsis
thaliana sequence At1g26560 beta-glucosidase like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 449
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 230 tgggaatgggccgccgggtacacctccagattcgggctctacttcgtggactacaa 285
||||||||||| || |||||||| |||||||| |||||||| || || ||||||||
Sbjct: 190 tgggaatgggcagcagggtacacttccagatttgggctctattttgttgactacaa 245
>gb|BQ697291.1|BQ697291 NXPV_055_C02_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_055_C02 5' similar to Arabidopsis
thaliana sequence At1g26560 beta-glucosidase like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 449
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 230 tgggaatgggccgccgggtacacctccagattcgggctctacttcgtggactacaa 285
||||||||||| || |||||||| |||||||| |||||||| || || ||||||||
Sbjct: 190 tgggaatgggcagcagggtacacttccagatttgggctctattttgttgactacaa 245
>gb|CO162557.1|CO162557 FLD1_36_C02.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_36_C02_A029 3', mRNA sequence
Length = 649
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 230 tgggaatgggccgccgggtacacctccagattcgggctctacttcgtggactacaa 285
||||||||||| || |||||||| |||||||| |||||||| || || ||||||||
Sbjct: 299 tgggaatgggcagcggggtacacttccagatttgggctctattttgttgactacaa 354
>gb|CO164776.1|CO164776 FLD1_50_F04.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_50_F04_A029 3', mRNA sequence
Length = 751
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 230 tgggaatgggccgccgggtacacctccagattcgggctctacttcgtggactacaa 285
||||||||||| || |||||||| |||||||| |||||||| || || ||||||||
Sbjct: 442 tgggaatgggcagcagggtacacttccagatttgggctctattttgttgactacaa 497
>gb|DR019869.1|DR019869 STRS1_33_B04.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_33_B04_A034 3', mRNA sequence
Length = 868
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 230 tgggaatgggccgccgggtacacctccagattcgggctctacttcgtggactacaa 285
||||||||||| || |||||||| |||||||| |||||||| || || ||||||||
Sbjct: 560 tgggaatgggcagcagggtacacttccagatttgggctctattttgttgactacaa 615
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 64,162
Number of Sequences: 355925
Number of extensions: 64162
Number of successful extensions: 18685
Number of sequences better than 0.5: 9
Number of HSP's better than 0.5 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18676
Number of HSP's gapped (non-prelim): 9
length of query: 733
length of database: 217,277,237
effective HSP length: 19
effective length of query: 714
effective length of database: 210,514,662
effective search space: 150307468668
effective search space used: 150307468668
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)