BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2306434.2.3
(3914 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
dbj|BD235986.1| Materials and method for modification of pl... 125 1e-026
gb|AY262817.1| Pinus radiata cellulose synthase (CesA6) mRN... 125 1e-026
gb|AY262819.1| Pinus radiata cellulose synthase (CesA8) mRN... 125 1e-026
gb|AY789651.1| Pinus taeda cellulose synthase catalytic sub... 117 4e-024
gb|DR162195.1|DR162195 RTFE1_16_G12.b1_A029 Roots minus iro... 115 1e-023
gb|AW985238.1|AW985238 NXNV_132_G11_F Nsf Xylem Normal wood... 113 6e-023
gb|DR080401.1|DR080401 RTFEPL1_22_A02.g1_A029 Roots plus ad... 111 2e-022
gb|AY262818.1| Pinus radiata cellulose synthase (CesA7) mRN... 109 9e-022
gb|AY262821.1| Pinus radiata cellulose synthase (CesA2) mRN... 109 9e-022
gb|DR744890.1|DR744890 RTCU1_25_C12.g1_A029 Roots plus adde... 107 3e-021
gb|AY262816.1| Pinus radiata cellulose synthase (CesA5) mRN... 107 3e-021
gb|BX000643.1|BX000643 BX000643 Pinus pinaster xylem Pinus ... 105 1e-020
gb|BG317558.1|BG317558 NXPV_003_B08_F NXPV (Nsf Xylem Plani... 100 8e-019
gb|BQ196805.1|BQ196805 NXLV105_E07_F NXLV (Nsf Xylem Late w... 100 8e-019
gb|BX682714.1|BX682714 BX682714 Pinus pinaster differenciat... 100 8e-019
gb|CO201610.1|CO201610 RTCNT2_7_A01.b1_A029 Root control 2 ... 100 8e-019
gb|CO369942.1|CO369942 RTK1_55_A04.g1_A029 Roots minus pota... 100 8e-019
gb|DR686101.1|DR686101 EST1076179 Normalized pine embryo li... 100 8e-019
dbj|BD236020.1| Materials and method for modification of pl... 100 8e-019
gb|AY639654.1| Pinus radiata cellulose synthase catalytic s... 100 8e-019
gb|AY789652.1| Pinus taeda cellulose synthase catalytic sub... 100 8e-019
gb|BI202889.1|BI202889 NXPV_091_H09_F NXPV (Nsf Xylem Plani... 94 5e-017
gb|AW056552.1|AW056552 ST51E06 Pine TriplEx shoot tip libra... 92 2e-016
gb|AY262820.1| Pinus radiata cellulose synthase (CesA10) mR... 92 2e-016
gb|AY789650.1| Pinus taeda cellulose synthase catalytic sub... 90 8e-016
gb|BX249248.1|BX249248 BX249248 Pinus pinaster differenciat... 88 3e-015
gb|DR101934.1|DR101934 STRR1_76_G04.g1_A033 Stem Response R... 88 3e-015
gb|BG275715.1|BG275715 NXSI_145_B01_F NXSI (Nsf Xylem Side ... 86 1e-014
gb|DR059426.1|DR059426 RTNIT1_17_D03.g1_A029 Roots minus ni... 84 5e-014
gb|AW985306.1|AW985306 NXNV_135_F04_F Nsf Xylem Normal wood... 82 2e-013
gb|CF672886.1|CF672886 RTCNT1_74_D05.g1_A029 Root control P... 82 2e-013
gb|DR054410.1|DR054410 RTCA1_17_D10.b1_A029 Roots minus cal... 82 2e-013
gb|DR110920.1|DR110920 RTS1_14_B08.b1_A029 Roots minus sulf... 82 2e-013
dbj|BD235989.1| Materials and method for modification of pl... 82 2e-013
gb|AW984889.1|AW984889 NXNV_100_C02_F Nsf Xylem Normal wood... 76 1e-011
gb|BE996873.1|BE996873 NXCI_103_E08_F NXCI (Nsf Xylem Compr... 76 1e-011
gb|CD024597.1|CD024597 NXRV056_C03_F NXRV (Nsf Xylem Root w... 76 1e-011
gb|CO169549.1|CO169549 NDL1_7_F09.g1_A029 Needles control P... 76 1e-011
gb|DR118589.1|DR118589 RTMG1_18_A07.b1_A029 Roots minus mag... 76 1e-011
gb|BX250234.1|BX250234 BX250234 Pinus pinaster differenciat... 72 2e-010
gb|BX252761.1|BX252761 BX252761 Pinus pinaster differenciat... 72 2e-010
gb|BX254358.1|BX254358 BX254358 Pinus pinaster differenciat... 72 2e-010
gb|BE187012.1|BE187012 NXNV_157_H10_F Nsf Xylem Normal wood... 72 2e-010
gb|BE657157.1|BE657157 NXCI_064_G04_F NXCI (Nsf Xylem Compr... 70 8e-010
gb|BF517368.1|BF517368 NXSI_013_F11_F NXSI (Nsf Xylem Side ... 70 8e-010
gb|AA556746.1|AA556746 588 Loblolly pine NA Pinus taeda cDN... 68 3e-009
gb|BG275945.1|BG275945 NXSI_149_G12_F NXSI (Nsf Xylem Side ... 66 1e-008
gb|BX682482.1|BX682482 BX682482 Pinus pinaster differenciat... 66 1e-008
gb|BX682490.1|BX682490 BX682490 Pinus pinaster differenciat... 66 1e-008
gb|CX646526.1|CX646526 COLD1_9_H07.g1_A029 Root cold Pinus ... 66 1e-008
gb|DR384721.1|DR384721 RTHG1_4_D04.b1_A029 Roots plus added... 66 1e-008
gb|BV079715.1| Pp_CesA3 Pinus pinaster megagametophytes Pin... 66 1e-008
gb|CF476470.1|CF476470 RTWW3_1_C10.g1_A022 Well-watered lob... 64 5e-008
gb|CF668221.1|CF668221 RTCNT1_35_D11.b1_A029 Root control P... 64 5e-008
gb|CO369260.1|CO369260 RTK1_46_B01.b1_A029 Roots minus pota... 64 5e-008
gb|DR110657.1|DR110657 RTS1_12_E03.b1_A029 Roots minus sulf... 64 5e-008
gb|DR110744.1|DR110744 RTS1_12_E03.g1_A029 Roots minus sulf... 64 5e-008
gb|AY262814.1| Pinus radiata cellulose synthase (CesA11) mR... 64 5e-008
gb|AW010875.1|AW010875 ST12E01 Pine TriplEx shoot tip libra... 62 2e-007
gb|BE451860.1|BE451860 NXCI_004_B09_F NXCI (Nsf Xylem Compr... 62 2e-007
gb|CD021726.1|CD021726 NXNV_159_F12_F Nsf Xylem Normal wood... 62 2e-007
gb|BV079717.1| Pp_CesA7 Pinus pinaster megagametophytes Pin... 62 2e-007
gb|BQ701215.1|BQ701215 NXSI_023_H05_F NXSI (Nsf Xylem Side ... 60 7e-007
gb|BQ701506.1|BQ701506 NXSI_065_D05_F NXSI (Nsf Xylem Side ... 60 7e-007
gb|BG832808.1|BG832808 NXPV_080_C10_F NXPV (Nsf Xylem Plani... 58 3e-006
gb|AI812887.1|AI812887 22B3 Pine Lambda Zap Xylem library P... 56 1e-005
gb|AW698053.1|AW698053 NXNV_072_F12_F Nsf Xylem Normal wood... 56 1e-005
gb|AW697996.1|AW697996 NXNV_079_C07_F Nsf Xylem Normal wood... 56 1e-005
gb|BE209203.1|BE209203 NXNV_147_C08_F Nsf Xylem Normal wood... 56 1e-005
gb|BF186171.1|BF186171 NXCI_133_H05_F NXCI (Nsf Xylem Compr... 56 1e-005
gb|BF610475.1|BF610475 NXSI_058_H08_F NXSI (Nsf Xylem Side ... 56 1e-005
gb|BG039408.1|BG039408 NXSI_098_F10_F NXSI (Nsf Xylem Side ... 56 1e-005
gb|BG039685.1|BG039685 NXSI_102_H08_F NXSI (Nsf Xylem Side ... 56 1e-005
gb|BM428045.1|BM428045 NXRV_008_A09_F NXRV (Nsf Xylem Root ... 56 1e-005
gb|BQ695648.1|BQ695648 NXPV_030_H04_F NXPV (Nsf Xylem Plani... 56 1e-005
gb|BQ697774.1|BQ697774 NXPV_052_F10_F NXPV (Nsf Xylem Plani... 56 1e-005
gb|BQ702475.1|BQ702475 NXSI_129_A10_F NXSI (Nsf Xylem Side ... 56 1e-005
gb|BQ702504.1|BQ702504 NXSI_129_D04_F NXSI (Nsf Xylem Side ... 56 1e-005
gb|BQ703105.1|BQ703105 NXSI_136_D09_F NXSI (Nsf Xylem Side ... 56 1e-005
gb|CF666095.1|CF666095 RTCNT1_20_E07.g1_A029 Root control P... 56 1e-005
gb|CF668299.1|CF668299 RTCNT1_35_D11.g1_A029 Root control P... 56 1e-005
gb|CO168623.1|CO168623 NDL1_1_A02.g1_A029 Needles control P... 56 1e-005
gb|CX651410.1|CX651410 COLD1_52_E07.b1_A029 Root cold Pinus... 56 1e-005
gb|DR060720.1|DR060720 RTNIT1_29_C08.g1_A029 Roots minus ni... 56 1e-005
gb|AH014290.1|SEG_AY764673S Pinus taeda isolate 11 cellulos... 56 1e-005
gb|AY764674.1|AY764673S2 Pinus taeda isolate 11 cellulose s... 56 1e-005
gb|AH014291.1|SEG_AY764675S Pinus taeda isolate 16 cellulos... 56 1e-005
gb|AY764676.1|AY764675S2 Pinus taeda isolate 16 cellulose s... 56 1e-005
gb|AH014292.1|SEG_AY764677S Pinus taeda isolate 25 cellulos... 56 1e-005
gb|AY764678.1|AY764677S2 Pinus taeda isolate 25 cellulose s... 56 1e-005
gb|AH014293.1|SEG_AY764679S Pinus taeda isolate 7 cellulose... 56 1e-005
gb|AY764680.1|AY764679S2 Pinus taeda isolate 7 cellulose sy... 56 1e-005
gb|AH014294.1|SEG_AY764681S Pinus taeda isolate 6 cellulose... 56 1e-005
gb|AY764682.1|AY764681S2 Pinus taeda isolate 6 cellulose sy... 56 1e-005
gb|AH014295.1|SEG_AY764683S Pinus taeda isolate 4 cellulose... 56 1e-005
gb|AY764684.1|AY764683S2 Pinus taeda isolate 4 cellulose sy... 56 1e-005
gb|AH014296.1|SEG_AY764685S Pinus taeda isolate 26 cellulos... 56 1e-005
gb|AY764686.1|AY764685S2 Pinus taeda isolate 26 cellulose s... 56 1e-005
gb|AH014297.1|SEG_AY764687S Pinus taeda isolate 9 cellulose... 56 1e-005
gb|AY764688.1|AY764687S2 Pinus taeda isolate 9 cellulose sy... 56 1e-005
gb|AH014298.1|SEG_AY764689S Pinus taeda isolate 23 cellulos... 56 1e-005
gb|AY764690.1|AY764689S2 Pinus taeda isolate 23 cellulose s... 56 1e-005
gb|AH014299.1|SEG_AY764691S Pinus taeda isolate 13 cellulos... 56 1e-005
gb|AY764692.1|AY764691S2 Pinus taeda isolate 13 cellulose s... 56 1e-005
gb|AH014300.1|SEG_AY764693S Pinus taeda isolate 30 cellulos... 56 1e-005
gb|AY764694.1|AY764693S2 Pinus taeda isolate 30 cellulose s... 56 1e-005
gb|AH014301.1|SEG_AY764695S Pinus taeda isolate 22 cellulos... 56 1e-005
gb|AY764696.1|AY764695S2 Pinus taeda isolate 22 cellulose s... 56 1e-005
gb|AH014302.1|SEG_AY764697S Pinus taeda isolate 32 cellulos... 56 1e-005
gb|AY764698.1|AY764697S2 Pinus taeda isolate 32 cellulose s... 56 1e-005
gb|AH014303.1|SEG_AY764699S Pinus taeda isolate 18 cellulos... 56 1e-005
gb|AY764700.1|AY764699S2 Pinus taeda isolate 18 cellulose s... 56 1e-005
gb|AH014304.1|SEG_AY764701S Pinus taeda isolate 10 cellulos... 56 1e-005
gb|AY764702.1|AY764701S2 Pinus taeda isolate 10 cellulose s... 56 1e-005
gb|AH014305.1|SEG_AY764703S Pinus taeda isolate 14 cellulos... 56 1e-005
gb|AY764704.1|AY764703S2 Pinus taeda isolate 14 cellulose s... 56 1e-005
gb|AH014306.1|SEG_AY764705S Pinus taeda isolate 21 cellulos... 56 1e-005
gb|AY764706.1|AY764705S2 Pinus taeda isolate 21 cellulose s... 56 1e-005
gb|AH014307.1|SEG_AY764707S Pinus taeda isolate 31 cellulos... 56 1e-005
gb|AY764708.1|AY764707S2 Pinus taeda isolate 31 cellulose s... 56 1e-005
gb|AH014308.1|SEG_AY764709S Pinus taeda isolate 5 cellulose... 56 1e-005
gb|AY764710.1|AY764709S2 Pinus taeda isolate 5 cellulose sy... 56 1e-005
gb|AH014309.1|SEG_AY764711S Pinus taeda isolate 2 cellulose... 56 1e-005
gb|AY764712.1|AY764711S2 Pinus taeda isolate 2 cellulose sy... 56 1e-005
gb|AH014310.1|SEG_AY764713S Pinus taeda isolate 3 cellulose... 56 1e-005
gb|AY764714.1|AY764713S2 Pinus taeda isolate 3 cellulose sy... 56 1e-005
gb|AH014311.1|SEG_AY764715S Pinus taeda isolate 19 cellulos... 56 1e-005
gb|AY764716.1|AY764715S2 Pinus taeda isolate 19 cellulose s... 56 1e-005
gb|AH014312.1|SEG_AY764717S Pinus taeda isolate 28 cellulos... 56 1e-005
gb|AY764718.1|AY764717S2 Pinus taeda isolate 28 cellulose s... 56 1e-005
gb|AH014313.1|SEG_AY764719S Pinus taeda isolate 17 cellulos... 56 1e-005
gb|AY764720.1|AY764719S2 Pinus taeda isolate 17 cellulose s... 56 1e-005
gb|AH014314.1|SEG_AY764721S Pinus taeda isolate 8 cellulose... 56 1e-005
gb|AY764722.1|AY764721S2 Pinus taeda isolate 8 cellulose sy... 56 1e-005
gb|AH014315.1|SEG_AY764723S Pinus taeda isolate 15 cellulos... 56 1e-005
gb|AY764724.1|AY764723S2 Pinus taeda isolate 15 cellulose s... 56 1e-005
gb|AH014316.1|SEG_AY764725S Pinus taeda isolate 1 cellulose... 56 1e-005
gb|AY764726.1|AY764725S2 Pinus taeda isolate 1 cellulose sy... 56 1e-005
gb|AH014317.1|SEG_AY764727S Pinus taeda isolate 29 cellulos... 56 1e-005
gb|AY764728.1|AY764727S2 Pinus taeda isolate 29 cellulose s... 56 1e-005
gb|AH014318.1|SEG_AY764729S Pinus taeda isolate 20 cellulos... 56 1e-005
gb|AY764730.1|AY764729S2 Pinus taeda isolate 20 cellulose s... 56 1e-005
gb|AH014320.1|SEG_AY764733S Pinus taeda isolate 12 cellulos... 56 1e-005
gb|AY764734.1|AY764733S2 Pinus taeda isolate 12 cellulose s... 56 1e-005
gb|AH014321.1|SEG_AY764735S Pinus taeda isolate 24 cellulos... 56 1e-005
gb|AY764736.1|AY764735S2 Pinus taeda isolate 24 cellulose s... 56 1e-005
gb|AY262815.1| Pinus radiata cellulose synthase (CesA3) mRN... 56 1e-005
gb|BQ698872.1|BQ698872 NXRV116_D12_F NXRV (Nsf Xylem Root w... 54 4e-005
gb|BQ700148.1|BQ700148 NXRV101_G08_F NXRV (Nsf Xylem Root w... 54 4e-005
gb|AY764673.1|AY764673S1 Pinus taeda isolate 11 cellulose s... 54 4e-005
gb|AY764675.1|AY764675S1 Pinus taeda isolate 16 cellulose s... 54 4e-005
gb|AY764677.1|AY764677S1 Pinus taeda isolate 25 cellulose s... 54 4e-005
gb|AY764679.1|AY764679S1 Pinus taeda isolate 7 cellulose sy... 54 4e-005
gb|AY764681.1|AY764681S1 Pinus taeda isolate 6 cellulose sy... 54 4e-005
gb|AY764683.1|AY764683S1 Pinus taeda isolate 4 cellulose sy... 54 4e-005
gb|AY764685.1|AY764685S1 Pinus taeda isolate 26 cellulose s... 54 4e-005
gb|AY764687.1|AY764687S1 Pinus taeda isolate 9 cellulose sy... 54 4e-005
gb|AY764689.1|AY764689S1 Pinus taeda isolate 23 cellulose s... 54 4e-005
gb|AY764691.1|AY764691S1 Pinus taeda isolate 13 cellulose s... 54 4e-005
gb|AY764693.1|AY764693S1 Pinus taeda isolate 30 cellulose s... 54 4e-005
gb|AY764695.1|AY764695S1 Pinus taeda isolate 22 cellulose s... 54 4e-005
gb|AY764697.1|AY764697S1 Pinus taeda isolate 32 cellulose s... 54 4e-005
gb|AY764699.1|AY764699S1 Pinus taeda isolate 18 cellulose s... 54 4e-005
gb|AY764701.1|AY764701S1 Pinus taeda isolate 10 cellulose s... 54 4e-005
gb|AY764703.1|AY764703S1 Pinus taeda isolate 14 cellulose s... 54 4e-005
gb|AY764705.1|AY764705S1 Pinus taeda isolate 21 cellulose s... 54 4e-005
gb|AY764707.1|AY764707S1 Pinus taeda isolate 31 cellulose s... 54 4e-005
gb|AY764709.1|AY764709S1 Pinus taeda isolate 5 cellulose sy... 54 4e-005
gb|AY764711.1|AY764711S1 Pinus taeda isolate 2 cellulose sy... 54 4e-005
gb|AY764713.1|AY764713S1 Pinus taeda isolate 3 cellulose sy... 54 4e-005
gb|AY764715.1|AY764715S1 Pinus taeda isolate 19 cellulose s... 54 4e-005
gb|AY764717.1|AY764717S1 Pinus taeda isolate 28 cellulose s... 54 4e-005
gb|AY764719.1|AY764719S1 Pinus taeda isolate 17 cellulose s... 54 4e-005
gb|AY764721.1|AY764721S1 Pinus taeda isolate 8 cellulose sy... 54 4e-005
gb|AY764723.1|AY764723S1 Pinus taeda isolate 15 cellulose s... 54 4e-005
gb|AY764725.1|AY764725S1 Pinus taeda isolate 1 cellulose sy... 54 4e-005
gb|AY764727.1|AY764727S1 Pinus taeda isolate 29 cellulose s... 54 4e-005
gb|AY764729.1|AY764729S1 Pinus taeda isolate 20 cellulose s... 54 4e-005
gb|AH014319.1|SEG_AY764731S Pinus taeda isolate 27 cellulos... 54 4e-005
gb|AY764731.1|AY764731S1 Pinus taeda isolate 27 cellulose s... 54 4e-005
gb|AY764733.1|AY764733S1 Pinus taeda isolate 12 cellulose s... 54 4e-005
gb|AY764735.1|AY764735S1 Pinus taeda isolate 24 cellulose s... 54 4e-005
gb|DR020730.1|DR020730 STRS1_38_H10.g1_A034 Shoot tip pitch... 52 2e-004
gb|BV102457.1| AY531556.SNP2 Pinus pinaster megagametophyte... 52 2e-004
gb|AY531556.1| Pinus pinaster putative cellulose synthase g... 52 2e-004
gb|BF221043.1|BF221043 NXCI_162_E11_F NXCI (Nsf Xylem Compr... 50 7e-004
gb|BG673833.1|BG673833 NXPV_075_F11_F NXPV (Nsf Xylem Plani... 50 7e-004
gb|BQ698421.1|BQ698421 NXPV_069_F11_F NXPV (Nsf Xylem Plani... 50 7e-004
gb|CF390276.1|CF390276 RTDR2_18_A03.g1_A021 Loblolly pine r... 50 7e-004
gb|DR684943.1|DR684943 EST1075020 Normalized pine embryo li... 50 7e-004
gb|DR687054.1|DR687054 EST1077132 Normalized pine embryo li... 50 7e-004
gb|DR692054.1|DR692054 EST1082141 Normalized pine embryo li... 50 7e-004
gb|DT632612.1|DT632612 EST1147543 Normalized pine embryo li... 50 7e-004
gb|DT633819.1|DT633819 EST1148750 Normalized pine embryo li... 50 7e-004
gb|BE656835.1|BE656835 NXCI_040_B06_F NXCI (Nsf Xylem Compr... 48 0.003
gb|BF010934.1|BF010934 NXCI_094_H06_F NXCI (Nsf Xylem Compr... 48 0.003
gb|BF778499.1|BF778499 NXSI_085_D12_F NXSI (Nsf Xylem Side ... 48 0.003
gb|BQ696934.1|BQ696934 NXPV_047_A09_F NXPV (Nsf Xylem Plani... 48 0.003
gb|CD017522.1|CD017522 NXCI_124_B01_F NXCI (Nsf Xylem Compr... 48 0.003
gb|AA556522.1|AA556522 377 Loblolly pine C Pinus taeda cDNA... 46 0.011
gb|AW011234.1|AW011234 ST18D02 Pine TriplEx shoot tip libra... 46 0.011
gb|BX249614.1|BX249614 BX249614 Pinus pinaster differenciat... 46 0.011
gb|BX254022.1|BX254022 BX254022 Pinus pinaster differenciat... 46 0.011
gb|BE520100.1|BE520100 NXCI_016_G11_F NXCI (Nsf Xylem Compr... 46 0.011
gb|BE643804.1|BE643804 NXCI_047_D12_F NXCI (Nsf Xylem Compr... 46 0.011
gb|BF777175.1|BF777175 NXSI_066_C05_F NXSI (Nsf Xylem Side ... 46 0.011
gb|BF778225.1|BF778225 NXSI_083_H07_F NXSI (Nsf Xylem Side ... 46 0.011
gb|BF778814.1|BF778814 NXSI_087_D09_F NXSI (Nsf Xylem Side ... 46 0.011
gb|BQ291066.1|BQ291066 NXRV055_C03_F NXRV (Nsf Xylem Root w... 46 0.011
gb|CF396363.1|CF396363 RTDS2_21_F06.g1_A021 Drought-stresse... 46 0.011
gb|CF478733.1|CF478733 RTWW3_16_G10.g1_A022 Well-watered lo... 46 0.011
gb|CO369344.1|CO369344 RTK1_46_B01.g1_A029 Roots minus pota... 46 0.011
gb|CV031645.1|CV031645 RTNACL1_2_G07.g1_A029 Roots plus add... 46 0.011
gb|DR096307.1|DR096307 STRR1_27_D08.b1_A033 Stem Response R... 46 0.011
gb|DR096386.1|DR096386 STRR1_27_D08.g1_A033 Stem Response R... 46 0.011
gb|AA566934.1|AA566934 988 Loblolly pine CA Pinus taeda cDN... 44 0.043
gb|AW289623.1|AW289623 NXNV003H02F Nsf Xylem Normal wood Ve... 44 0.043
gb|AL750979.1|AL750979 AL750979 RS Pinus pinaster cDNA clon... 44 0.043
gb|BX250396.1|BX250396 BX250396 Pinus pinaster differenciat... 44 0.043
gb|BX254834.1|BX254834 BX254834 Pinus pinaster differenciat... 44 0.043
gb|BX255542.1|BX255542 BX255542 Pinus pinaster differenciat... 44 0.043
gb|BE996842.1|BE996842 NXCI_103_B03_F NXCI (Nsf Xylem Compr... 44 0.043
gb|BF517850.1|BF517850 NXSI_029_A11_F NXSI (Nsf Xylem Side ... 44 0.043
gb|BF610064.1|BF610064 NXSI_054_C11_F NXSI (Nsf Xylem Side ... 44 0.043
gb|BF778216.1|BF778216 NXSI_083_G10_F NXSI (Nsf Xylem Side ... 44 0.043
gb|CD016846.1|CD016846 NXCI_064_H04_F NXCI (Nsf Xylem Compr... 44 0.043
gb|CD022200.1|CD022200 NXPV_024_F02_F NXPV (Nsf Xylem Plani... 44 0.043
gb|CD028231.1|CD028231 NXNV003H02 Nsf Xylem Normal wood Ver... 44 0.043
gb|CF385550.1|CF385550 RTDR1_4_A05.g1_A015 Loblolly pine ro... 44 0.043
gb|CF386899.1|CF386899 RTDR1_9_G11.g1_A015 Loblolly pine ro... 44 0.043
gb|CF387577.1|CF387577 RTDR1_20_A11.g1_A015 Loblolly pine r... 44 0.043
gb|CF389746.1|CF389746 RTDR2_5_F05.b1_A021 Loblolly pine ro... 44 0.043
gb|CF389774.1|CF389774 RTDR2_5_F05.g1_A021 Loblolly pine ro... 44 0.043
gb|CF391079.1|CF391079 RTDR3_3_A02.g1_A022 Loblolly pine ro... 44 0.043
gb|CF391856.1|CF391856 RTDR3_10_A01.g1_A022 Loblolly pine r... 44 0.043
gb|CF392397.1|CF392397 RTDR3_7_A11.g1_A022 Loblolly pine ro... 44 0.043
gb|CF399783.1|CF399783 RTWW1_1_C11.b1_A015 Well-watered lob... 44 0.043
gb|CF399857.1|CF399857 RTWW1_1_C11.g1_A015 Well-watered lob... 44 0.043
gb|CF400220.1|CF400220 RTWW1_4_G09.b1_A015 Well-watered lob... 44 0.043
gb|CF400300.1|CF400300 RTWW1_4_G09.g1_A015 Well-watered lob... 44 0.043
gb|CF401032.1|CF401032 RTWW1_9_E01.g1_A015 Well-watered lob... 44 0.043
gb|CF401194.1|CF401194 RTWW1_10_A11.g1_A015 Well-watered lo... 44 0.043
gb|CF401360.1|CF401360 RTWW1_12_E07.b1_A015 Well-watered lo... 44 0.043
gb|CF401413.1|CF401413 RTWW1_12_A06.g1_A015 Well-watered lo... 44 0.043
gb|CF401422.1|CF401422 RTWW1_12_E07.g1_A015 Well-watered lo... 44 0.043
gb|CF401676.1|CF401676 RTWW1_14_B11.b1_A015 Well-watered lo... 44 0.043
gb|CF401761.1|CF401761 RTWW1_14_B11.g1_A015 Well-watered lo... 44 0.043
gb|CF471806.1|CF471806 RTDS1_6_E01.g1_A015 Drought-stressed... 44 0.043
gb|CF475380.1|CF475380 RTWW2_13_F05.g1_A021 Well-watered lo... 44 0.043
gb|CF475417.1|CF475417 RTWW2_12_F05.b1_A021 Well-watered lo... 44 0.043
gb|CF475542.1|CF475542 RTWW2_12_F05.g1_A021 Well-watered lo... 44 0.043
gb|CF478045.1|CF478045 RTWW3_17_A12.g1_A022 Well-watered lo... 44 0.043
gb|CF479624.1|CF479624 RTWW3_11_H06.b1_A022 Well-watered lo... 44 0.043
gb|CF663519.1|CF663519 RTCNT1_3_H06.b1_A029 Root control Pi... 44 0.043
gb|CF663587.1|CF663587 RTCNT1_3_H06.g1_A029 Root control Pi... 44 0.043
gb|CF665403.1|CF665403 RTCNT1_15_G05.g1_A029 Root control P... 44 0.043
gb|CF665584.1|CF665584 RTCNT1_17_A05.b1_A029 Root control P... 44 0.043
gb|CF666575.1|CF666575 RTCNT1_24_G10.b1_A029 Root control P... 44 0.043
gb|CF666635.1|CF666635 RTCNT1_24_G10.g1_A029 Root control P... 44 0.043
gb|CF667796.1|CF667796 RTCNT1_32_C05.g1_A029 Root control P... 44 0.043
gb|CF672731.1|CF672731 RTCNT1_73_C11.g1_A029 Root control P... 44 0.043
gb|CR392467.1|CR392467 CR392467 RN Pinus pinaster cDNA clon... 44 0.043
gb|CN783573.1|CN783573 EST782264 Sequencing ESTs from loblo... 44 0.043
gb|CN783574.1|CN783574 EST782265 Sequencing ESTs from loblo... 44 0.043
gb|CN785338.1|CN785338 EST784029 Sequencing ESTs from loblo... 44 0.043
gb|CN785375.1|CN785375 EST784066 Sequencing ESTs from loblo... 44 0.043
gb|CN785647.1|CN785647 EST784338 Sequencing ESTs from loblo... 44 0.043
gb|CO172840.1|CO172840 NDL1_32_F05.b1_A029 Needles control ... 44 0.043
gb|CO172922.1|CO172922 NDL1_32_F05.g1_A029 Needles control ... 44 0.043
gb|CO198379.1|CO198379 GEO1_13_F06.b1_A029 Root gravitropis... 44 0.043
gb|CO198820.1|CO198820 GEO1_16_G06.g1_A029 Root gravitropis... 44 0.043
gb|CO200738.1|CO200738 RTCNT2_1_E11.b1_A029 Root control 2 ... 44 0.043
gb|CO200774.1|CO200774 RTCNT2_1_A07.g1_A029 Root control 2 ... 44 0.043
gb|CO200813.1|CO200813 RTCNT2_1_E11.g1_A029 Root control 2 ... 44 0.043
gb|CO409930.1|CO409930 EST840315 Sequencing ESTs from loblo... 44 0.043
gb|CO361015.1|CO361015 NDL2_2_C09.b1_A029 Needles control 2... 44 0.043
gb|CO361077.1|CO361077 NDL2_2_C09.g1_A029 Needles control 2... 44 0.043
gb|CO366593.1|CO366593 RTK1_28_G04.g1_A029 Roots minus pota... 44 0.043
gb|CO367082.1|CO367082 RTK1_32_B11.b1_A029 Roots minus pota... 44 0.043
gb|CO367314.1|CO367314 RTK1_33_C07.g1_A029 Roots minus pota... 44 0.043
gb|CO367895.1|CO367895 RTK1_37_H06.b1_A029 Roots minus pota... 44 0.043
gb|CO367978.1|CO367978 RTK1_37_H06.g1_A029 Roots minus pota... 44 0.043
gb|CO369417.1|CO369417 RTK1_47_B03.b1_A029 Roots minus pota... 44 0.043
gb|CO369482.1|CO369482 RTK1_47_B03.g1_A029 Roots minus pota... 44 0.043
gb|CV032754.1|CV032754 RTNACL1_18_D05.b1_A029 Roots plus ad... 44 0.043
gb|CV032835.1|CV032835 RTNACL1_18_D05.g1_A029 Roots plus ad... 44 0.043
gb|CV032910.1|CV032910 RTNACL1_19_C02.b1_A029 Roots plus ad... 44 0.043
gb|CV032988.1|CV032988 RTNACL1_19_C02.g1_A029 Roots plus ad... 44 0.043
gb|CV034149.1|CV034149 RTNACL1_39_B06.b1_A029 Roots plus ad... 44 0.043
gb|CV034225.1|CV034225 RTNACL1_39_B06.g1_A029 Roots plus ad... 44 0.043
gb|CV034366.1|CV034366 RTNACL1_40_B01.g1_A029 Roots plus ad... 44 0.043
gb|CV035670.1|CV035670 RTNACL1_41_D06.g1_A029 Roots plus ad... 44 0.043
gb|CV035679.1|CV035679 RTNACL1_41_E06.g1_A029 Roots plus ad... 44 0.043
gb|CV136358.1|CV136358 EST847567 Sequencing ESTs from loblo... 44 0.043
gb|CV136841.1|CV136841 EST848050 Sequencing ESTs from loblo... 44 0.043
gb|CV137381.1|CV137381 EST848590 Sequencing ESTs from loblo... 44 0.043
gb|CV137428.1|CV137428 EST848637 Sequencing ESTs from loblo... 44 0.043
gb|CV138160.1|CV138160 EST849369 Sequencing ESTs from loblo... 44 0.043
gb|CV138880.1|CV138880 EST850089 Sequencing ESTs from loblo... 44 0.043
gb|CV143791.1|CV143791 EST855000 Sequencing ESTs from loblo... 44 0.043
gb|CV144068.1|CV144068 EST855277 Sequencing ESTs from loblo... 44 0.043
gb|CV144290.1|CV144290 EST855499 Sequencing ESTs from loblo... 44 0.043
gb|CV144852.1|CV144852 EST856061 Sequencing ESTs from loblo... 44 0.043
gb|CV144867.1|CV144867 EST856076 Sequencing ESTs from loblo... 44 0.043
gb|CV146364.1|CV146364 EST857573 Sequencing ESTs from loblo... 44 0.043
gb|CV147483.1|CV147483 EST858692 Sequencing ESTs from loblo... 44 0.043
gb|CV147753.1|CV147753 EST858962 Sequencing ESTs from loblo... 44 0.043
gb|CX646747.1|CX646747 COLD1_11_F07.b1_A029 Root cold Pinus... 44 0.043
gb|CX713412.1|CX713412 RTPQ1_9_B11.b1_A032 Roots treated wi... 44 0.043
gb|DN445857.1|DN445857 EST941656 Sequencing ESTs from loblo... 44 0.043
gb|DN448176.1|DN448176 EST943975 Sequencing ESTs from loblo... 44 0.043
gb|DN450566.1|DN450566 EST946365 Sequencing ESTs from loblo... 44 0.043
gb|DN451035.1|DN451035 EST946834 Sequencing ESTs from loblo... 44 0.043
gb|DN454239.1|DN454239 EST950038 Sequencing ESTs from loblo... 44 0.043
gb|DN455573.1|DN455573 EST951372 Sequencing ESTs from loblo... 44 0.043
gb|DN456394.1|DN456394 EST952193 Sequencing ESTs from loblo... 44 0.043
gb|DN461098.1|DN461098 EST956897 Sequencing ESTs from loblo... 44 0.043
gb|DN463346.1|DN463346 EST959145 Sequencing ESTs from loblo... 44 0.043
gb|DR010919.1|DR010919 HEAT1_2_D06.b1_A029 Root at 37 C for... 44 0.043
gb|DR010993.1|DR010993 HEAT1_2_D06.g1_A029 Root at 37 C for... 44 0.043
gb|DR012958.1|DR012958 HEAT1_16_D01.b1_A029 Root at 37 C fo... 44 0.043
gb|DR013040.1|DR013040 HEAT1_16_D01.g1_A029 Root at 37 C fo... 44 0.043
gb|DR013048.1|DR013048 HEAT1_16_D10.g1_A029 Root at 37 C fo... 44 0.043
gb|DR013426.1|DR013426 HEAT1_19_F08.b1_A029 Root at 37 C fo... 44 0.043
gb|DR013514.1|DR013514 HEAT1_19_F08.g1_A029 Root at 37 C fo... 44 0.043
gb|DR013738.1|DR013738 HEAT1_21_E10.b1_A029 Root at 37 C fo... 44 0.043
gb|DR014126.1|DR014126 HEAT1_23_C07.g1_A029 Root at 37 C fo... 44 0.043
gb|DR014299.1|DR014299 HEAT1_24_D08.g1_A029 Root at 37 C fo... 44 0.043
gb|DR014444.1|DR014444 HEAT1_49_C01.g1_A029 Root at 37 C fo... 44 0.043
gb|DR018669.1|DR018669 STRS1_25_A03.b1_A034 Shoot tip pitch... 44 0.043
gb|DR018670.1|DR018670 STRS1_25_A04.b1_A034 Shoot tip pitch... 44 0.043
gb|DR018744.1|DR018744 STRS1_25_A03.g1_A034 Shoot tip pitch... 44 0.043
gb|DR049098.1|DR049098 RTBOR1_13_G09.b1_A029 Roots plus add... 44 0.043
gb|DR050549.1|DR050549 RTBOR1_24_E12.b1_A029 Roots plus add... 44 0.043
gb|DR050631.1|DR050631 RTBOR1_24_E12.g1_A029 Roots plus add... 44 0.043
gb|DR053346.1|DR053346 RTCA1_10_C01.g1_A029 Roots minus cal... 44 0.043
gb|DR054238.1|DR054238 RTCA1_16_C08.b1_A029 Roots minus cal... 44 0.043
gb|DR055028.1|DR055028 RTCA1_21_C06.b1_A029 Roots minus cal... 44 0.043
gb|DR055313.1|DR055313 RTCA1_22_H05.g2_A029 Roots minus cal... 44 0.043
gb|DR058401.1|DR058401 RTNIT1_11_C08.g1_A029 Roots minus ni... 44 0.043
gb|DR072144.1|DR072144 RTDK1_24_G12.b1_A029 Roots, dark Pin... 44 0.043
gb|DR072220.1|DR072220 RTDK1_24_G12.g1_A029 Roots, dark Pin... 44 0.043
gb|DR072452.1|DR072452 RTDK1_26_H07.b1_A029 Roots, dark Pin... 44 0.043
gb|DR072539.1|DR072539 RTDK1_27_B01.b1_A029 Roots, dark Pin... 44 0.043
gb|DR072616.1|DR072616 RTDK1_27_B01.g1_A029 Roots, dark Pin... 44 0.043
gb|DR078929.1|DR078929 RTFEPL1_7_G08.g1_A029 Roots plus add... 44 0.043
gb|DR079152.1|DR079152 RTFEPL1_9_H12.b1_A029 Roots plus add... 44 0.043
gb|DR079228.1|DR079228 RTFEPL1_9_H12.g1_A029 Roots plus add... 44 0.043
gb|DR079337.1|DR079337 RTFEPL1_10_D06.g1_A029 Roots plus ad... 44 0.043
gb|DR080901.1|DR080901 RTFEPL1_26_B08.b1_A029 Roots plus ad... 44 0.043
gb|DR089060.1|DR089060 RTAL1_6_G05.b1_A029 Roots plus added... 44 0.043
gb|DR089147.1|DR089147 RTAL1_6_G05.g1_A029 Roots plus added... 44 0.043
gb|DR111097.1|DR111097 RTS1_15_F02.b1_A029 Roots minus sulf... 44 0.043
gb|DR111154.1|DR111154 RTS1_15_F02.g1_A029 Roots minus sulf... 44 0.043
gb|DR111624.1|DR111624 RTS1_19_D09.b1_A029 Roots minus sulf... 44 0.043
gb|DR112324.1|DR112324 RTS1_27_H09.b1_A029 Roots minus sulf... 44 0.043
gb|DR112393.1|DR112393 RTS1_27_H09.g1_A029 Roots minus sulf... 44 0.043
gb|DR117967.1|DR117967 RTMG1_10_G09.b1_A029 Roots minus mag... 44 0.043
gb|DR120287.1|DR120287 RTMG1_28_F01.g2_A029 Roots minus mag... 44 0.043
gb|DR161468.1|DR161468 RTFE1_12_A08.b1_A029 Roots minus iro... 44 0.043
gb|DR161543.1|DR161543 RTFE1_12_A08.g1_A029 Roots minus iro... 44 0.043
gb|DR163719.1|DR163719 RTFE1_44_B09.g1_A029 Roots minus iro... 44 0.043
gb|DR165149.1|DR165149 RTPHOS1_3_A11.b1_A029 Roots minus ph... 44 0.043
gb|DR165220.1|DR165220 RTPHOS1_3_A11.g1_A029 Roots minus ph... 44 0.043
gb|DR166740.1|DR166740 RTPHOS1_14_D06.b1_A029 Roots minus p... 44 0.043
gb|DR166809.1|DR166809 RTPHOS1_14_D06.g1_A029 Roots minus p... 44 0.043
gb|DR167653.1|DR167653 RTPHOS1_20_E11.b1_A029 Roots minus p... 44 0.043
gb|DR167738.1|DR167738 RTPHOS1_20_E11.g1_A029 Roots minus p... 44 0.043
gb|DR168343.1|DR168343 RTPHOS1_24_G07.g1_A029 Roots minus p... 44 0.043
gb|DR169430.1|DR169430 RTPHOS1_32_H05.b1_A029 Roots minus p... 44 0.043
gb|DR177869.1|DR177869 RTMNUT1_7_H05.g1_A029 Roots minus mi... 44 0.043
gb|DR180521.1|DR180521 RTMNUT1_33_E01.b1_A029 Roots minus m... 44 0.043
gb|DR180603.1|DR180603 RTMNUT1_33_E01.g1_A029 Roots minus m... 44 0.043
gb|DR181352.1|DR181352 RTMNUT1_38_H08.b2_A029 Roots minus m... 44 0.043
gb|DR181431.1|DR181431 RTMNUT1_38_H08.g2_A029 Roots minus m... 44 0.043
gb|DR742376.1|DR742376 RTCU1_3_D04.g2_A029 Roots plus added... 44 0.043
gb|DR743058.1|DR743058 RTCU1_13_G01.b1_A029 Roots plus adde... 44 0.043
gb|DR743135.1|DR743135 RTCU1_13_G01.g1_A029 Roots plus adde... 44 0.043
gb|DR746325.1|DR746325 RTCU1_36_E12.b1_A029 Roots plus adde... 44 0.043
gb|DR746402.1|DR746402 RTCU1_36_E12.g1_A029 Roots plus adde... 44 0.043
gb|DT624786.1|DT624786 EST1158881 Sequencing ESTs from lobl... 44 0.043
gb|DT624635.1|DT624635 EST1158970 Sequencing ESTs from lobl... 44 0.043
gb|DT624685.1|DT624685 EST1159020 Sequencing ESTs from lobl... 44 0.043
gb|DT627068.1|DT627068 EST1160144 Sequencing ESTs from lobl... 44 0.043
gb|AW290811.1|AW290811 NXNV047B05F Nsf Xylem Normal wood Ve... 42 0.17
gb|BE209216.1|BE209216 NXNV_147_D10_F Nsf Xylem Normal wood... 42 0.17
gb|CD017587.1|CD017587 NXCI_129_A12_F NXCI (Nsf Xylem Compr... 42 0.17
gb|CF400082.1|CF400082 RTWW1_3_H02.b1_A015 Well-watered lob... 42 0.17
gb|CF401072.1|CF401072 RTWW1_9_B11.g1_A015 Well-watered lob... 42 0.17
gb|CF664199.1|CF664199 RTCNT1_8_C11.b1_A029 Root control Pi... 42 0.17
gb|CF672653.1|CF672653 RTCNT1_73_C11.b1_A029 Root control P... 42 0.17
gb|CO162454.1|CO162454 FLD1_35_H11.b1_A029 Root flooded Pin... 42 0.17
gb|CO162535.1|CO162535 FLD1_35_H11.g1_A029 Root flooded Pin... 42 0.17
gb|CO369720.1|CO369720 RTK1_53_C04.b1_A029 Roots minus pota... 42 0.17
gb|DN464871.1|DN464871 EST960670 Sequencing ESTs from loblo... 42 0.17
gb|DR012279.1|DR012279 HEAT1_11_C11.g1_A029 Root at 37 C fo... 42 0.17
gb|DR014843.1|DR014843 HEAT1_52_A09.b1_A029 Root at 37 C fo... 42 0.17
gb|DR014927.1|DR014927 HEAT1_52_A09.g1_A029 Root at 37 C fo... 42 0.17
gb|DR056120.1|DR056120 RTCA1_28_E09.b1_A029 Roots minus cal... 42 0.17
gb|DR056200.1|DR056200 RTCA1_28_E09.g1_A029 Roots minus cal... 42 0.17
gb|DR056704.1|DR056704 RTCA1_32_B03.b1_A029 Roots minus cal... 42 0.17
gb|DR056779.1|DR056779 RTCA1_32_B03.g1_A029 Roots minus cal... 42 0.17
gb|DR117492.1|DR117492 RTMG1_7_G05.b1_A029 Roots minus magn... 42 0.17
gb|DR117581.1|DR117581 RTMG1_7_G05.g1_A029 Roots minus magn... 42 0.17
gb|DR118142.1|DR118142 RTMG1_11_A03.g1_A029 Roots minus mag... 42 0.17
gb|DR167502.1|DR167502 RTPHOS1_19_F03.b1_A029 Roots minus p... 42 0.17
gb|DR167584.1|DR167584 RTPHOS1_19_F03.g1_A029 Roots minus p... 42 0.17
gb|DR178642.1|DR178642 RTMNUT1_13_B12.b1_A029 Roots minus m... 42 0.17
gb|DR178715.1|DR178715 RTMNUT1_13_B12.g1_A029 Roots minus m... 42 0.17
gb|DR746063.1|DR746063 RTCU1_34_A06.g1_A029 Roots plus adde... 42 0.17
gb|DT627434.1|DT627434 EST1160510 Sequencing ESTs from lobl... 42 0.17
>dbj|BD235986.1| Materials and method for modification of plant cell wall
polysaccharides
Length = 383
Score = 125 bits (63), Expect = 1e-026
Identities = 282/355 (79%)
Strand = Plus / Minus
Query: 1775 tgaaaacacatccagtacccacataaatgggcccttgaataccatccaaacctttcatgt 1834
||||||| |||||||| |||||||| | ||||| || || ||||| | ||| |||||||
Sbjct: 358 tgaaaacgcatccagtccccacatacactggcccctggatgccatctagacccttcatgt 299
Query: 1835 tgatatcaaaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaa 1894
||||||| || || ||| ||| ||||| |||||||||||||| || ||||||||| | |
Sbjct: 298 tgatatcgaagaaaacagtgtttctgtttgcatatcgatcatggcgatcaataccatcga 239
Query: 1895 acctctgagggaactgtacatagcacactttcttccccaccaaaggatccatcatgaaac 1954
| |||||||||||||| |||||||||| |||||| || | |||||||| | ||||
Sbjct: 238 atctctgagggaactgaacatagcacagtttctttccaagttggggatccatgagaaaac 179
Query: 1955 acatagcctcttttatggccttgctattgttgatgtagtgatcacagtccaagttcaata 2014
|||| ||||| | |||||| || ||||||| ||||||||||| |||| |||||| |
Sbjct: 178 acattgcctcccgcacggccttactgttgttgagatagtgatcacaatccaggttcaaaa 119
Query: 2015 ggtatgcagcatttgataagacagcagagacacggaccagtgcattcatggcaccagcct 2074
| ||| ||||||| || || |||||||| || ||||| || ||||||||||| || |
Sbjct: 118 tgaatggggcatttgttagaactgcagagactcgaaccagggcgttcatggcaccggctt 59
Query: 2075 tcttgtgatggttataacctggcctcttttctctcgagacataaacaaggcgagg 2129
||||||| || | ||| || || |||||||| | || ||||| |||||||||||
Sbjct: 58 tcttgtggtgctgatatccaggtctcttttcacgagaaacatagacaaggcgagg 4
>gb|AY262817.1| Pinus radiata cellulose synthase (CesA6) mRNA, partial cds
Length = 2489
Score = 125 bits (63), Expect = 1e-026
Identities = 282/355 (79%)
Strand = Plus / Minus
Query: 1775 tgaaaacacatccagtacccacataaatgggcccttgaataccatccaaacctttcatgt 1834
||||||| |||||||| |||||||| | ||||| || || ||||| | ||| |||||||
Sbjct: 731 tgaaaacgcatccagtccccacatacactggcccctggatgccatctagacccttcatgt 672
Query: 1835 tgatatcaaaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaa 1894
||||||| || || ||| ||| ||||| |||||||||||||| || ||||||||| | |
Sbjct: 671 tgatatcgaagaaaacagtgtttctgtttgcatatcgatcatggcgatcaataccatcga 612
Query: 1895 acctctgagggaactgtacatagcacactttcttccccaccaaaggatccatcatgaaac 1954
| |||||||||||||| |||||||||| |||||| || | |||||||| | ||||
Sbjct: 611 atctctgagggaactgaacatagcacagtttctttccaagttggggatccatgagaaaac 552
Query: 1955 acatagcctcttttatggccttgctattgttgatgtagtgatcacagtccaagttcaata 2014
|||| ||||| | |||||| || ||||||| ||||||||||| |||| |||||| |
Sbjct: 551 acattgcctcccgcacggccttactgttgttgagatagtgatcacaatccaggttcaaaa 492
Query: 2015 ggtatgcagcatttgataagacagcagagacacggaccagtgcattcatggcaccagcct 2074
| ||| ||||||| || || |||||||| || ||||| || ||||||||||| || |
Sbjct: 491 tgaatggggcatttgttagaactgcagagactcgaaccagggcgttcatggcaccggctt 432
Query: 2075 tcttgtgatggttataacctggcctcttttctctcgagacataaacaaggcgagg 2129
||||||| || | ||| || || |||||||| | || ||||| |||||||||||
Sbjct: 431 tcttgtggtgctgatatccaggtctcttttcacgagaaacatagacaaggcgagg 377
Score = 63.9 bits (32), Expect = 5e-008
Identities = 68/80 (85%)
Strand = Plus / Minus
Query: 544 ggcgtcctgttctgcctccccaccagacccttgaggaacgggtacaggtggacgatcacc 603
||||| ||||||||||| |||| |||||||||||||| || ||||| || | ||||||
Sbjct: 1959 ggcgttctgttctgccttcccagaagacccttgaggaagggatacagatgcaatatcacc 1900
Query: 604 cagaaggcgaagaagagctt 623
||| |||||||||| |||||
Sbjct: 1899 cagcaggcgaagaatagctt 1880
Score = 54.0 bits (27), Expect = 4e-005
Identities = 69/83 (83%)
Strand = Plus / Minus
Query: 1282 cgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatcgatccataa 1341
||||| ||| |||||||||| || || || |||| |||||||||||| | ||| |||||
Sbjct: 1218 cgccaaccacggcagtgcattttgaagcctgtcaggatatcctctgtcaccgaaccatat 1159
Query: 1342 atccagccaatctcttttcccca 1364
||||| || ||||| ||||||||
Sbjct: 1158 atccatccgatctcctttcccca 1136
Score = 44.1 bits (22), Expect = 0.043
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 2176 acctgaatcattccaggatgatcgcg 2201
||||||||||||||||| ||||||||
Sbjct: 330 acctgaatcattccagggtgatcgcg 305
Score = 44.1 bits (22), Expect = 0.043
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 2420 actttttgctgaaaggaacccatttc 2445
||||||||| ||||||||||||||||
Sbjct: 86 actttttgcagaaaggaacccatttc 61
>gb|AY262819.1| Pinus radiata cellulose synthase (CesA8) mRNA, partial cds
Length = 2287
Score = 125 bits (63), Expect = 1e-026
Identities = 282/355 (79%)
Strand = Plus / Minus
Query: 1775 tgaaaacacatccagtacccacataaatgggcccttgaataccatccaaacctttcatgt 1834
||||||| |||||||| |||||||| | ||||| || || ||||| | ||| |||||||
Sbjct: 580 tgaaaacgcatccagtccccacatacactggcccctggatgccatctagacccttcatgt 521
Query: 1835 tgatatcaaaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaa 1894
||||||| || || ||| ||| ||||| |||||||||||||| || ||||||||| | |
Sbjct: 520 tgatatcgaagaaaacagtgtttctgtttgcatatcgatcatggcgatcaataccatcga 461
Query: 1895 acctctgagggaactgtacatagcacactttcttccccaccaaaggatccatcatgaaac 1954
| |||||||||||||| |||||||||| |||||| || | |||||||| | ||||
Sbjct: 460 atctctgagggaactgaacatagcacagtttctttccaagttggggatccatgagaaaac 401
Query: 1955 acatagcctcttttatggccttgctattgttgatgtagtgatcacagtccaagttcaata 2014
|||| ||||| | |||||| || ||||||| ||||||||||| |||| |||||| |
Sbjct: 400 acattgcctcccgcacggccttactgttgttgagatagtgatcacaatccaggttcaaaa 341
Query: 2015 ggtatgcagcatttgataagacagcagagacacggaccagtgcattcatggcaccagcct 2074
| ||| ||||||| || || |||||||| || ||||| || ||||||||||| || |
Sbjct: 340 tgaatggggcatttgttagaactgcagagactcgaaccagggcgttcatggcaccggctt 281
Query: 2075 tcttgtgatggttataacctggcctcttttctctcgagacataaacaaggcgagg 2129
||||||| || | ||| || || |||||||| | || ||||| |||||||||||
Sbjct: 280 tcttgtggtgctgatatccaggtctcttttcacgagaaacatagacaaggcgagg 226
Score = 63.9 bits (32), Expect = 5e-008
Identities = 68/80 (85%)
Strand = Plus / Minus
Query: 544 ggcgtcctgttctgcctccccaccagacccttgaggaacgggtacaggtggacgatcacc 603
||||| ||||||||||| |||| |||||||||||||| || ||||| || | ||||||
Sbjct: 1847 ggcgttctgttctgccttcccagaagacccttgaggaagggatacagatgcaatatcacc 1788
Query: 604 cagaaggcgaagaagagctt 623
||| |||||||||| |||||
Sbjct: 1787 cagcaggcgaagaatagctt 1768
Score = 44.1 bits (22), Expect = 0.043
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 2176 acctgaatcattccaggatgatcgcg 2201
||||||||||||||||| ||||||||
Sbjct: 179 acctgaatcattccagggtgatcgcg 154
Score = 42.1 bits (21), Expect = 0.17
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 1282 cgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatcgatccataa 1341
||||| ||| |||||||||| || || || |||| |||||||||||| | ||| |||||
Sbjct: 1106 cgccaaccacggcagtgcattttgaagcctgtcaggatatcctctgtcaccgaaccatat 1047
Query: 1342 atcca 1346
|||||
Sbjct: 1046 atcca 1042
>gb|AY789651.1| Pinus taeda cellulose synthase catalytic subunit (CesA2) mRNA,
complete cds
Length = 3478
Score = 117 bits (59), Expect = 4e-024
Identities = 281/355 (79%)
Strand = Plus / Minus
Query: 1775 tgaaaacacatccagtacccacataaatgggcccttgaataccatccaaacctttcatgt 1834
||||||| |||||||| |||||||| | ||||| || || ||||| | ||| |||||||
Sbjct: 1879 tgaaaacgcatccagtccccacatacactggcccctggatgccatctagacccttcatgt 1820
Query: 1835 tgatatcaaaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaa 1894
||||||| || || ||| ||| ||||| |||||||||||||| || ||||||||| | |
Sbjct: 1819 tgatatcgaagaaaacagtgtttctgtttgcatatcgatcatggcgatcaataccatcga 1760
Query: 1895 acctctgagggaactgtacatagcacactttcttccccaccaaaggatccatcatgaaac 1954
| |||||||||||||| |||||||||| |||||| || | |||||||| | ||||
Sbjct: 1759 atctctgagggaactgaacatagcacagtttctttccaagttggggatccatgagaaaac 1700
Query: 1955 acatagcctcttttatggccttgctattgttgatgtagtgatcacagtccaagttcaata 2014
|||| ||||| | |||||| || ||||||| ||||||||||| |||| |||||| |
Sbjct: 1699 acattgcctcccgcacggccttactgttgttgagatagtgatcacaatccaggttcaaaa 1640
Query: 2015 ggtatgcagcatttgataagacagcagagacacggaccagtgcattcatggcaccagcct 2074
| ||| ||||||| || || |||||||| || ||||| || ||||||||||| || |
Sbjct: 1639 tgaatggggcatttgttagaactgcagagactcgaaccagggcgttcatggcaccggctt 1580
Query: 2075 tcttgtgatggttataacctggcctcttttctctcgagacataaacaaggcgagg 2129
||||||| || | ||| || || ||||| || | || ||||| |||||||||||
Sbjct: 1579 tcttgtggtgctgatatccaggtctcttctcacgagaaacatagacaaggcgagg 1525
Score = 63.9 bits (32), Expect = 5e-008
Identities = 68/80 (85%)
Strand = Plus / Minus
Query: 544 ggcgtcctgttctgcctccccaccagacccttgaggaacgggtacaggtggacgatcacc 603
||||| ||||||||||| |||| |||||||||||||| || ||||| || | ||||||
Sbjct: 3107 ggcgttctgttctgccttcccagaagacccttgaggaagggatacagatgcaatatcacc 3048
Query: 604 cagaaggcgaagaagagctt 623
||| |||||||||| |||||
Sbjct: 3047 cagcaggcgaagaatagctt 3028
Score = 54.0 bits (27), Expect = 4e-005
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 2701 ggaagccactttgggaactgatcaagaatccagga 2735
|||| |||||| |||||||||||||||||||||||
Sbjct: 953 ggaaaccacttggggaactgatcaagaatccagga 919
Score = 46.1 bits (23), Expect = 0.011
Identities = 68/83 (81%)
Strand = Plus / Minus
Query: 1282 cgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatcgatccataa 1341
||||| ||| |||||||||| || || || |||| |||||||||||| | || |||||
Sbjct: 2366 cgccaaccacggcagtgcattttgaagcctgtcaggatatcctctgtcactgaaccatat 2307
Query: 1342 atccagccaatctcttttcccca 1364
||||| || ||||| ||||||||
Sbjct: 2306 atccatccgatctcctttcccca 2284
Score = 44.1 bits (22), Expect = 0.043
Identities = 64/78 (82%)
Strand = Plus / Minus
Query: 822 caccttcagcaggccctggaacaccgcgaacagatgcgccgaaacgcctccgatgaccca 881
|||||| |||||||| || || || || || ||||| || || || ||||| ||||||||
Sbjct: 2826 caccttgagcaggccttgaaaaacagcaaaaagatgagcagagacccctccaatgaccca 2767
Query: 882 gaactgctcgttcctcca 899
|||||| ||||| |||||
Sbjct: 2766 gaactgttcgtttctcca 2749
Score = 44.1 bits (22), Expect = 0.043
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 2176 acctgaatcattccaggatgatcgcg 2201
||||||||||||||||| ||||||||
Sbjct: 1478 acctgaatcattccagggtgatcgcg 1453
Score = 44.1 bits (22), Expect = 0.043
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 2420 actttttgctgaaaggaacccatttc 2445
||||||||| ||||||||||||||||
Sbjct: 1234 actttttgcagaaaggaacccatttc 1209
>gb|DR162195.1|DR162195 RTFE1_16_G12.b1_A029 Roots minus iron Pinus taeda cDNA clone
RTFE1_16_G12_A029 3', mRNA sequence
Length = 626
Score = 115 bits (58), Expect = 1e-023
Identities = 133/158 (84%)
Strand = Plus / Plus
Query: 1273 taaatagaccgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatc 1332
|||||||||||||| |||||||| ||||| || || || ||||| ||||||||||| | |
Sbjct: 90 taaatagaccgccatccatggcaatgcattttgaagcctgtcaatatatcctctgtaacc 149
Query: 1333 gatccataaatccagccaatctcttttccccagtcggtcttgtcttcgtagccgcagctg 1392
|| ||||||||||| |||| ||| ||||||||||| || || ||||| ||||| |||||
Sbjct: 150 gaaccataaatccatccaacctcctttccccagtctgttttatcttcatagccacagcta 209
Query: 1393 ataacatgtatagcttccttcagaagagaagctggact 1430
|||||||| || ||||| || ||||| ||||| |||||
Sbjct: 210 ataacatgaatggcttcttttagaagtgaagcaggact 247
Score = 97.6 bits (49), Expect = 3e-018
Identities = 112/133 (84%)
Strand = Plus / Plus
Query: 1693 caccacttgggccagcagttgcaagttcttgatggtggcttctttgttttaggagcatca 1752
||||| || |||||||| || ||||| |||| |||| ||||| | |||||||||||||
Sbjct: 492 caccattttggccagcaattacaagtccttgttggttccttctcagctttaggagcatca 551
Query: 1753 taaccatatagtgcctgccgtctgaaaacacatccagtacccacataaatgggcccttga 1812
| ||||| ||||| |||| ||||||||||||||||||||| ||||| ||||| || |||
Sbjct: 552 aatccataaagtgcttgccttctgaaaacacatccagtaccaacatatatgggtccctga 611
Query: 1813 ataccatccaaac 1825
|| ||||||||||
Sbjct: 612 atgccatccaaac 624
>gb|AW985238.1|AW985238 NXNV_132_G11_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_132_G11 5' similar to Arabidopsis thaliana sequence
At4g39350 cellulose synthase catalytic subunit (Ath-A)
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 425
Score = 113 bits (57), Expect = 6e-023
Identities = 216/272 (79%)
Strand = Plus / Minus
Query: 1740 tttaggagcatcataaccatatagtgcctgccgtctgaaaacacatccagtacccacata 1799
||||||||||||| | ||||| ||||| || |||||||||||||||||||| |||||
Sbjct: 395 tttaggagcatcaaatccataaagtgcttgnnnnctgaaaacacatccagtaccaacata 336
Query: 1800 aatgggcccttgaataccatccaaacctttcatgttgatatcaaaaaagacaacgttcct 1859
||||| | |||| |||||||| ||||||| |||||||| || || || ||||| |
Sbjct: 335 tatgggtcnnngaatgccatccaannctttcatattgatatcgaagaaaaccacgttgcg 276
Query: 1860 gttagcatatcgatcatgacggtcaataccaccaaacctctgagggaactgtacatagca 1919
|| ||||| ||||| || | ||||||||| |||| ||||| || ||||| ||||| ||
Sbjct: 275 attggcataacgatcgtgcctatcaataccatcaaatctctgtggaaactgcacataaca 216
Query: 1920 cactttcttccccaccaaaggatccatcatgaaacacatagcctcttttatggccttgct 1979
|||||||| || || ||||||||||||||||||||| | || || ||||| ||
Sbjct: 215 gactttctttccaacagtaggatccatcatgaaacacatggattcacgaattgccttact 156
Query: 1980 attgttgatgtagtgatcacagtccaagttca 2011
|||||| || || |||||||| ||||||||||
Sbjct: 155 attgtttatataatgatcacaatccaagttca 124
>gb|DR080401.1|DR080401 RTFEPL1_22_A02.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_22_A02_A029 5', mRNA sequence
Length = 741
Score = 111 bits (56), Expect = 2e-022
Identities = 260/328 (79%)
Strand = Plus / Minus
Query: 1775 tgaaaacacatccagtacccacataaatgggcccttgaataccatccaaacctttcatgt 1834
||||||| || ||||| |||||||| | ||||| || || ||||| | ||| |||||||
Sbjct: 669 tgaaaacgcacccagtccccacatacactggcccctggatgccatctagacccttcatgt 610
Query: 1835 tgatatcaaaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaa 1894
||||||| || || ||| ||| ||||| |||||||||||||| || ||||||||| | |
Sbjct: 609 tgatatcgaagaaaacagtgtttctgtttgcatatcgatcatggcgatcaataccatcga 550
Query: 1895 acctctgagggaactgtacatagcacactttcttccccaccaaaggatccatcatgaaac 1954
| |||||||||||||| |||||||||| |||||| || | |||||||| | ||||
Sbjct: 549 atctctgagggaactgaacatagcacagtttctttccaagttggggatccatgagaaaac 490
Query: 1955 acatagcctcttttatggccttgctattgttgatgtagtgatcacagtccaagttcaata 2014
|||| ||||| | |||||| || ||||||| ||||||||||| |||| |||||| |
Sbjct: 489 acattgcctcccgcacggccttactgttgttgagatagtgatcacaatccaggttcaaaa 430
Query: 2015 ggtatgcagcatttgataagacagcagagacacggaccagtgcattcatggcaccagcct 2074
| ||| ||||||| || || |||||||| || ||||| || ||||||||||| || |
Sbjct: 429 tgaatggggcatttgttagaactgcagagactcgaaccagggcgttcatggcaccggctt 370
Query: 2075 tcttgtgatggttataacctggcctctt 2102
||||||| || | ||| || ||||||||
Sbjct: 369 tcttgtggtgctgatatccaggcctctt 342
Score = 44.1 bits (22), Expect = 0.043
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 2176 acctgaatcattccaggatgatcgcg 2201
||||||||||||||||| ||||||||
Sbjct: 268 acctgaatcattccagggtgatcgcg 243
>gb|AY262818.1| Pinus radiata cellulose synthase (CesA7) mRNA, partial cds
Length = 2588
Score = 109 bits (55), Expect = 9e-022
Identities = 280/355 (78%)
Strand = Plus / Minus
Query: 1775 tgaaaacacatccagtacccacataaatgggcccttgaataccatccaaacctttcatgt 1834
||||||| |||||||| |||||||| | ||||| || || ||||| | ||| |||||||
Sbjct: 952 tgaaaacgcatccagtccccacatacactggcccctggatgccatctagacccttcatgt 893
Query: 1835 tgatatcaaaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaa 1894
||||||| || || ||| ||| ||||| |||||||||||||| || ||||||||| | |
Sbjct: 892 tgatatcgaagaaaacagtgtttctgtttgcatatcgatcatggcgatcaataccatcga 833
Query: 1895 acctctgagggaactgtacatagcacactttcttccccaccaaaggatccatcatgaaac 1954
| |||||||||||||| |||||||||| |||||| || | |||||||| | ||||
Sbjct: 832 atctctgagggaactgaacatagcacagtttctttccaagttggggatccatgagaaaac 773
Query: 1955 acatagcctcttttatggccttgctattgttgatgtagtgatcacagtccaagttcaata 2014
|||| ||||| | |||||| || ||||||| ||||||||||| |||| |||||| |
Sbjct: 772 acattgcctcccgcacggccttactgttgttgagatagtgatcacaatccaggttcaaaa 713
Query: 2015 ggtatgcagcatttgataagacagcagagacacggaccagtgcattcatggcaccagcct 2074
| | | ||||||| || || |||||||| || ||||| || ||||||||||| || |
Sbjct: 712 tgaacggggcatttgttagaactgcagagactcgaaccagggcgttcatggcaccggctt 653
Query: 2075 tcttgtgatggttataacctggcctcttttctctcgagacataaacaaggcgagg 2129
||||||| || | ||| || || ||||| || | || ||||| |||||||||||
Sbjct: 652 tcttgtggtgctgatatccaggtctcttctcacgagaaacatagacaaggcgagg 598
Score = 63.9 bits (32), Expect = 5e-008
Identities = 68/80 (85%)
Strand = Plus / Minus
Query: 544 ggcgtcctgttctgcctccccaccagacccttgaggaacgggtacaggtggacgatcacc 603
||||| ||||||||||| |||| |||||||||||||| || ||||| || | ||||||
Sbjct: 2180 ggcgttctgttctgccttcccagaagacccttgaggaagggatacagatgcaatatcacc 2121
Query: 604 cagaaggcgaagaagagctt 623
||| |||||||||| |||||
Sbjct: 2120 cagcaggcgaagaatagctt 2101
Score = 46.1 bits (23), Expect = 0.011
Identities = 68/83 (81%)
Strand = Plus / Minus
Query: 1282 cgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatcgatccataa 1341
||||| ||| |||||||||| || || || |||| |||||||||||| | || |||||
Sbjct: 1439 cgccaaccacggcagtgcattttgaagcctgtcaggatatcctctgtcactgaaccatat 1380
Query: 1342 atccagccaatctcttttcccca 1364
||||| || ||||| ||||||||
Sbjct: 1379 atccatccgatctcctttcccca 1357
Score = 44.1 bits (22), Expect = 0.043
Identities = 64/78 (82%)
Strand = Plus / Minus
Query: 822 caccttcagcaggccctggaacaccgcgaacagatgcgccgaaacgcctccgatgaccca 881
|||||| |||||||| || || || || || ||||| || || || ||||| ||||||||
Sbjct: 1899 caccttgagcaggccttgaaaaacagcaaaaagatgagcagagacccctccaatgaccca 1840
Query: 882 gaactgctcgttcctcca 899
|||||| ||||| |||||
Sbjct: 1839 gaactgttcgtttctcca 1822
Score = 44.1 bits (22), Expect = 0.043
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 2176 acctgaatcattccaggatgatcgcg 2201
||||||||||||||||| ||||||||
Sbjct: 551 acctgaatcattccagggtgatcgcg 526
Score = 44.1 bits (22), Expect = 0.043
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 2420 actttttgctgaaaggaacccatttc 2445
||||||||| ||||||||||||||||
Sbjct: 307 actttttgcagaaaggaacccatttc 282
>gb|AY262821.1| Pinus radiata cellulose synthase (CesA2) mRNA, partial cds
Length = 3603
Score = 109 bits (55), Expect = 9e-022
Identities = 319/407 (78%)
Strand = Plus / Minus
Query: 2209 tttccaggccaggggcttccatcttgcattgtccatccttcctcaggaaccttttgggct 2268
|||||||||||||| | ||||||||||| ||| || || ||||| ||||| |||||
Sbjct: 1430 tttccaggccagggagtgccatcttgcataacccagccctcttcaggtaccttctgggcc 1371
Query: 2269 tttgcaaccaaggcattgatccttaccttgaattcctcgtattctctcttcatcgccctc 2328
|| ||||| | |||||||||| ||||||||||| || |||||||||||||| ||||||
Sbjct: 1370 ttcgcaacaagcgcattgatccgaaccttgaattcttcatattctctcttcattgccctc 1311
Query: 2329 ctctccctaacaaatgaagcagcaaccttgtctttcaggtagtctatcttctgttggaag 2388
| ||| | ||||| | || || ||||| |||| ||| || || ||| || ||||
Sbjct: 1310 cgctcttttacaaaagtaggctgtactttgtccttcaagtaatccattttcagtgagaag 1251
Query: 2389 taccactcaggagcacgaggctcgatattaaactttttgctgaaaggaacccatttcttt 2448
|||||||| ||||| | || || || ||||||||||||| || || ||||||||| ||
Sbjct: 1250 taccactctggagctctgggttcaatgttaaactttttgcaaaatggcacccatttcctt 1191
Query: 2449 gcaaattcagatgtttcagacaatgcttcaaacgtaagcattgcagcaccatcatcagaa 2508
|||||||| || ||||| || | | ||| || || | ||| || || ||||| ||||||
Sbjct: 1190 gcaaattctgaagtttctgaaagggattcgaaagtcaacatggctgctccatcgtcagaa 1131
Query: 2509 acatagcaggagaccttctcaaccggataatccacagaaaggatggaaaggacagtgttc 2568
||||||||||| ||||| ||||| |||||||||||||| || || || || ||||||||
Sbjct: 1130 acatagcaggaaaccttgtcaacaggataatccacagacagaatcgacagaacagtgttt 1071
Query: 2569 gctgtgaccaagggaggttcctttgtgggatcaaccgtactgacaaa 2615
|| || || | ||||| |||||| || ||||| |||||||||||
Sbjct: 1070 gcagtaacaagaggaggctcctttaaagggtcaactgtactgacaaa 1024
Score = 75.8 bits (38), Expect = 1e-011
Identities = 142/174 (81%), Gaps = 2/174 (1%)
Strand = Plus / Minus
Query: 1237 gcagaacctttgaatgcaggccgcttcgggatgcagtaaatagaccgccagccatg-gca 1295
||||| |||||||||||||| || || ||||||||||| || | ||||||| | |||
Sbjct: 2381 gcagaccctttgaatgcagggcgaggaggcatgcagtaaatggatctccagccacgagca 2322
Query: 1296 gtgcatcttaaatccagtcaagatatcctctgtgatcgatccataaatccagccaatctc 1355
||||| ||||||||||| || ||||| || || | || ||||||||||| ||||||||
Sbjct: 2321 -tgcattttaaatccagttaaaatatcttccgtcactgaaccataaatccaaccaatctc 2263
Query: 1356 ttttccccagtcggtcttgtcttcgtagccgcagctgataacatgtatagcttc 1409
||||||||| ||||||||||| || || ||||| |||||||| ||||||||
Sbjct: 2262 acgtccccagtctgtcttgtcttcatacccacagctaataacatggatagcttc 2209
Score = 54.0 bits (27), Expect = 4e-005
Identities = 59/67 (88%), Gaps = 2/67 (2%)
Strand = Plus / Minus
Query: 1782 acatccagtacccacataaa-tgggcccttgaataccatccaaacctttcatgttgatat 1840
|||||| ||||||||||||| |||||||| || | |||||||||||||| | |||||||
Sbjct: 1857 acatcctgtacccacataaactgggccctggatt-ccatccaaacctttgagattgatat 1799
Query: 1841 caaaaaa 1847
|||||||
Sbjct: 1798 caaaaaa 1792
Score = 42.1 bits (21), Expect = 0.17
Identities = 54/65 (83%)
Strand = Plus / Minus
Query: 577 aggaacgggtacaggtggacgatcacccagaaggcgaagaagagcttcccgaacaggggg 636
||||| ||||| || ||||| |||||||| || || || ||||| || |||||||||||
Sbjct: 3044 aggaaagggtaaagatggacaatcacccaaaacgcaaaaaagagttttccgaacagggga 2985
Query: 637 cccca 641
|||||
Sbjct: 2984 cccca 2980
>gb|DR744890.1|DR744890 RTCU1_25_C12.g1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_25_C12_A029 5', mRNA sequence
Length = 754
Score = 107 bits (54), Expect = 3e-021
Identities = 129/154 (83%)
Strand = Plus / Minus
Query: 1775 tgaaaacacatccagtacccacataaatgggcccttgaataccatccaaacctttcatgt 1834
||||||| |||||||| |||||||| | ||||| || || ||||| | ||| |||||||
Sbjct: 183 tgaaaacgcatccagtccccacatacactggcccctggatgccatctagacccttcatgt 124
Query: 1835 tgatatcaaaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaa 1894
||||||| || || ||| ||| ||||| |||||||||||||| || ||||||||| | |
Sbjct: 123 tgatatcgaagaaaacagtgtttctgtttgcatatcgatcatggcgatcaataccatcga 64
Query: 1895 acctctgagggaactgtacatagcacactttctt 1928
| |||||||||||||| |||||||||| ||||||
Sbjct: 63 atctctgagggaactgaacatagcacagtttctt 30
Score = 46.1 bits (23), Expect = 0.011
Identities = 68/83 (81%)
Strand = Plus / Minus
Query: 1282 cgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatcgatccataa 1341
||||| ||| |||||||||| || || || |||| |||||||||||| | || |||||
Sbjct: 670 cgccaaccacggcagtgcattttgaagcctgtcaggatatcctctgtcactgaaccatat 611
Query: 1342 atccagccaatctcttttcccca 1364
||||| || ||||| ||||||||
Sbjct: 610 atccatccgatctcctttcccca 588
>gb|AY262816.1| Pinus radiata cellulose synthase (CesA5) mRNA, partial cds
Length = 1989
Score = 107 bits (54), Expect = 3e-021
Identities = 129/154 (83%)
Strand = Plus / Minus
Query: 1775 tgaaaacacatccagtacccacataaatgggcccttgaataccatccaaacctttcatgt 1834
||||||| |||||||| |||||||| | ||||| || || ||||| | ||| |||||||
Sbjct: 173 tgaaaacgcatccagtccccacatacactggcccctggatgccatctagacccttcatgt 114
Query: 1835 tgatatcaaaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaa 1894
||||||| || || ||| ||| ||||| |||||||||||||| || ||||||||| | |
Sbjct: 113 tgatatcgaagaaaacagtgtttctgtttgcatatcgatcatggcgatcaataccatcga 54
Query: 1895 acctctgagggaactgtacatagcacactttctt 1928
| |||||||||||||| |||||||||| ||||||
Sbjct: 53 atctctgagggaactgaacatagcacagtttctt 20
Score = 63.9 bits (32), Expect = 5e-008
Identities = 68/80 (85%)
Strand = Plus / Minus
Query: 544 ggcgtcctgttctgcctccccaccagacccttgaggaacgggtacaggtggacgatcacc 603
||||| ||||||||||| |||| |||||||||||||| || ||||| || | ||||||
Sbjct: 1401 ggcgttctgttctgccttcccagaagacccttgaggaagggatacagatgcaatatcacc 1342
Query: 604 cagaaggcgaagaagagctt 623
||| |||||||||| |||||
Sbjct: 1341 cagcaggcgaagaatagctt 1322
Score = 54.0 bits (27), Expect = 4e-005
Identities = 69/83 (83%)
Strand = Plus / Minus
Query: 1282 cgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatcgatccataa 1341
||||| ||| |||||||||| || || || |||| |||||||||||| | ||| |||||
Sbjct: 660 cgccaaccacggcagtgcattttgaagcctgtcaggatatcctctgtcaccgaaccatat 601
Query: 1342 atccagccaatctcttttcccca 1364
||||| || ||||| ||||||||
Sbjct: 600 atccatccgatctcctttcccca 578
Score = 44.1 bits (22), Expect = 0.043
Identities = 64/78 (82%)
Strand = Plus / Minus
Query: 822 caccttcagcaggccctggaacaccgcgaacagatgcgccgaaacgcctccgatgaccca 881
|||||| |||||||| || || || || || ||||| || || || ||||| ||||||||
Sbjct: 1120 caccttgagcaggccttgaaaaacagcaaaaagatgagcagagacccctccaatgaccca 1061
Query: 882 gaactgctcgttcctcca 899
|||||| ||||| |||||
Sbjct: 1060 gaactgttcgtttctcca 1043
>gb|BX000643.1|BX000643 BX000643 Pinus pinaster xylem Pinus pinaster cDNA clone PPJM13, mRNA
sequence
Length = 520
Score = 105 bits (53), Expect = 1e-020
Identities = 122/145 (84%)
Strand = Plus / Minus
Query: 1270 cagtaaatagaccgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtg 1329
|||||||| ||||||||||| | | ||||||||| |||||||||| || |||||||||
Sbjct: 500 cagtaaatggaccgccagcctcgactgtgcatcttgaatccagtcagaatgtcctctgtg 441
Query: 1330 atcgatccataaatccagccaatctcttttccccagtcggtcttgtcttcgtagccgcag 1389
| |||||||| ||||| |||| |||||||||||| || || |||||||| || || |||
Sbjct: 440 actgatccatagatccatccaagctcttttccccattccgttttgtcttcatatccccag 381
Query: 1390 ctgataacatgtatagcttccttca 1414
||||| ||||| ||||| |||||||
Sbjct: 380 ctgatgacatgaatagcctccttca 356
>gb|BG317558.1|BG317558 NXPV_003_B08_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_003_B08 5' similar to Arabidopsis
thaliana sequence At5g05170 cellulose synthase catalytic
subunit (Ath-B) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 536
Score = 99.6 bits (50), Expect = 8e-019
Identities = 146/178 (82%)
Strand = Plus / Minus
Query: 1237 gcagaacctttgaatgcaggccgcttcgggatgcagtaaatagaccgccagccatggcag 1296
||||| ||||||||||| | || || || || |||||||| ||||||||||| | |
Sbjct: 309 gcagaccctttgaatgctgctcgtttgggcatacagtaaatggaccgccagcctcgagtg 250
Query: 1297 tgcatcttaaatccagtcaagatatcctctgtgatcgatccataaatccagccaatctct 1356
|||||||| |||||||||| || |||||||||| |||||||| ||||| |||| ||||
Sbjct: 249 tgcatcttgaatccagtcagaatgtcctctgtgactgatccatagatccatccaagctct 190
Query: 1357 tttccccagtcggtcttgtcttcgtagccgcagctgataacatgtatagcttccttca 1414
|||||||| || || |||||||| || || |||||||| ||||| ||||| |||||||
Sbjct: 189 tttccccattccgttttgtcttcatatccacagctgatgacatgaatagcctccttca 132
>gb|BQ196805.1|BQ196805 NXLV105_E07_F NXLV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA
clone NXLV105_E07 5' similar to Arabidopsis thaliana
sequence At4g32410 cellulose synthase catalytic subunit
(RSW1) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 758
Score = 99.6 bits (50), Expect = 8e-019
Identities = 101/118 (85%)
Strand = Plus / Minus
Query: 1297 tgcatcttaaatccagtcaagatatcctctgtgatcgatccataaatccagccaatctct 1356
||||| ||||| |||||||| ||||| ||||||| || ||||||||||| |||||||||
Sbjct: 239 tgcattttaaacccagtcaaaatatcttctgtgacagaaccataaatccacccaatctct 180
Query: 1357 tttccccagtcggtcttgtcttcgtagccgcagctgataacatgtatagcttccttca 1414
|||||||| || | ||||||||| || || |||||||||||||| || ||||| ||||
Sbjct: 179 tttccccattctgacttgtcttcatatccacagctgataacatgaatggcttctttca 122
>gb|BX682714.1|BX682714 BX682714 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone 120E04 similar to Cellulose synthase, mRNA
sequence
Length = 431
Score = 99.6 bits (50), Expect = 8e-019
Identities = 101/118 (85%)
Strand = Plus / Minus
Query: 1297 tgcatcttaaatccagtcaagatatcctctgtgatcgatccataaatccagccaatctct 1356
||||| ||||| |||||||| ||||| ||||||| || ||||||||||| |||||||||
Sbjct: 326 tgcattttaaacccagtcaaaatatcttctgtgacagaaccataaatccacccaatctct 267
Query: 1357 tttccccagtcggtcttgtcttcgtagccgcagctgataacatgtatagcttccttca 1414
|||||||| || | ||||||||| || || |||||||||||||| || ||||| ||||
Sbjct: 266 tttccccattctgacttgtcttcatatccacagctgataacatgaatggcttctttca 209
>gb|CO201610.1|CO201610 RTCNT2_7_A01.b1_A029 Root control 2 (late) Pinus taeda cDNA clone
RTCNT2_7_A01_A029 3', mRNA sequence
Length = 681
Score = 99.6 bits (50), Expect = 8e-019
Identities = 101/118 (85%)
Strand = Plus / Plus
Query: 1297 tgcatcttaaatccagtcaagatatcctctgtgatcgatccataaatccagccaatctct 1356
||||| ||||| |||||||| ||||| ||||||| || ||||||||||| |||||||||
Sbjct: 182 tgcattttaaacccagtcaaaatatcttctgtgacagaaccataaatccacccaatctct 241
Query: 1357 tttccccagtcggtcttgtcttcgtagccgcagctgataacatgtatagcttccttca 1414
|||||||| || | ||||||||| || || |||||||||||||| || ||||| ||||
Sbjct: 242 tttccccattctgacttgtcttcatatccacagctgataacatgaatggcttctttca 299
>gb|CO369942.1|CO369942 RTK1_55_A04.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_55_A04_A029 5', mRNA sequence
Length = 695
Score = 99.6 bits (50), Expect = 8e-019
Identities = 101/118 (85%)
Strand = Plus / Minus
Query: 1297 tgcatcttaaatccagtcaagatatcctctgtgatcgatccataaatccagccaatctct 1356
||||| ||||| |||||||| ||||| ||||||| || ||||||||||| |||||||||
Sbjct: 191 tgcattttaaacccagtcaaaatatcttctgtgacagaaccataaatccacccaatctct 132
Query: 1357 tttccccagtcggtcttgtcttcgtagccgcagctgataacatgtatagcttccttca 1414
|||||||| || | ||||||||| || || |||||||||||||| || ||||| ||||
Sbjct: 131 tttccccattctgacttgtcttcatatccacagctgataacatgaatggcttctttca 74
>gb|DR686101.1|DR686101 EST1076179 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWABC32 3' end, mRNA sequence
Length = 737
Score = 99.6 bits (50), Expect = 8e-019
Identities = 101/118 (85%)
Strand = Plus / Minus
Query: 1297 tgcatcttaaatccagtcaagatatcctctgtgatcgatccataaatccagccaatctct 1356
||||| ||||| |||||||| ||||| ||||||| || ||||||||||| |||||||||
Sbjct: 617 tgcattttaaacccagtcaaaatatcttctgtgacagaaccataaatccacccaatctct 558
Query: 1357 tttccccagtcggtcttgtcttcgtagccgcagctgataacatgtatagcttccttca 1414
|||||||| || | ||||||||| || || |||||||||||||| || ||||| ||||
Sbjct: 557 tttccccattctgacttgtcttcatatccacagctgataacatgaatggcttctttca 500
Score = 93.7 bits (47), Expect = 5e-017
Identities = 110/131 (83%)
Strand = Plus / Minus
Query: 1789 gtacccacataaatgggcccttgaataccatccaaacctttcatgttgatatcaaaaaag 1848
||||||||||||| |||||||| |||||||| |||||| ||| | |||||||||| ||
Sbjct: 149 gtacccacataaacaggcccttggataccatcgaaacctctcaaggtgatatcaaagaac 90
Query: 1849 acaacgttcctgttagcatatcgatcatgacggtcaataccaccaaacctctgagggaac 1908
||| ||| | |||||||||||||| || || ||||| ||| |||| |||||||| |||
Sbjct: 89 acagtgttacgattagcatatcgatcgtgtcgatcaatgccatcaaatctctgaggaaac 30
Query: 1909 tgtacatagca 1919
|||||||||||
Sbjct: 29 tgtacatagca 19
>dbj|BD236020.1| Materials and method for modification of plant cell wall
polysaccharides
Length = 3851
Score = 99.6 bits (50), Expect = 8e-019
Identities = 146/178 (82%)
Strand = Plus / Minus
Query: 1237 gcagaacctttgaatgcaggccgcttcgggatgcagtaaatagaccgccagccatggcag 1296
||||| ||||||||||| | || || || || |||||||| ||||||||||| | |
Sbjct: 2590 gcagaccctttgaatgctgctcgtttgggcatacagtaaatggaccgccagcctcgagtg 2531
Query: 1297 tgcatcttaaatccagtcaagatatcctctgtgatcgatccataaatccagccaatctct 1356
|||||||| |||||||||| || |||||||||| |||||||| ||||| |||| ||||
Sbjct: 2530 tgcatcttgaatccagtcagaatgtcctctgtgactgatccatagatccatccaagctct 2471
Query: 1357 tttccccagtcggtcttgtcttcgtagccgcagctgataacatgtatagcttccttca 1414
|||||||| || || |||||||| || || |||||||| ||||| ||||| |||||||
Sbjct: 2470 tttccccattccgttttgtcttcatatccacagctgatgacatgaatagcctccttca 2413
Score = 99.6 bits (50), Expect = 8e-019
Identities = 239/302 (79%)
Strand = Plus / Minus
Query: 1783 catccagtacccacataaatgggcccttgaataccatccaaacctttcatgttgatatca 1842
|||||||| |||||||| | ||||||||||| ||||||| |||||||||||||||||||
Sbjct: 2086 catccagttcccacatatacaggcccttgaattccatccagacctttcatgttgatatca 2027
Query: 1843 aaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaaacctctga 1902
|| || || ||| | || || || || |||| || ||||||||| | || ||||||
Sbjct: 2026 aagaatacggtgtttcgattggcgtaacggtcattgcgatcaataccatcgaatctctga 1967
Query: 1903 gggaactgtacatagcacactttcttccccaccaaaggatccatcatgaaacacatagcc 1962
||||| || ||||| || ||||| |||| ||| |||||||||||| || ||||| |
Sbjct: 1966 gggaattggacataacagacttttctcccaacctgaggatccatcataaagcacatgcct 1907
Query: 1963 tcttttatggccttgctattgttgatgtagtgatcacagtccaagttcaataggtatgca 2022
|| | || |||||||||||||| |||||||||||||| |||| |||| | ||| |
Sbjct: 1906 tccctgattgccttgctattgttaatgtagtgatcacaatccagattcagcataaatgga 1847
Query: 2023 gcatttgataagacagcagagacacggaccagtgcattcatggcaccagccttcttgtga 2082
||||| | | |||||||| || || |||| |||||||||||||| ||||||||||||
Sbjct: 1846 gcattggtgagcacagcagaaacccgaaccaaagcattcatggcaccggccttcttgtga 1787
Query: 2083 tg 2084
||
Sbjct: 1786 tg 1785
Score = 61.9 bits (31), Expect = 2e-007
Identities = 46/51 (90%)
Strand = Plus / Minus
Query: 2706 ccactttgggaactgatcaagaatccaggacatcgcaaaccagatttcaca 2756
|||||| || ||||||||||||||||| |||| |||||||||||||||||
Sbjct: 1163 ccacttgggaaactgatcaagaatccatgacaaggcaaaccagatttcaca 1113
Score = 56.0 bits (28), Expect = 1e-005
Identities = 61/72 (84%)
Strand = Plus / Minus
Query: 552 gttctgcctccccaccagacccttgaggaacgggtacaggtggacgatcacccagaaggc 611
||||||||| |||| |||||||||||||| || |||||||| || || |||||||| ||
Sbjct: 3275 gttctgcctgcccatgagacccttgaggaaaggatacaggtgcacaatgacccagaatgc 3216
Query: 612 gaagaagagctt 623
||||| |||||
Sbjct: 3215 aaagaaaagctt 3204
Score = 56.0 bits (28), Expect = 1e-005
Identities = 76/92 (82%)
Strand = Plus / Minus
Query: 2230 tcttgcattgtccatccttcctcaggaaccttttgggcttttgcaaccaaggcattgatc 2289
|||||||||||||||||||||| || || || ||| ||||||||||| ||||||
Sbjct: 1639 tcttgcattgtccatccttccttgggcactttagaggcctttgcaaccaaccgattgatg 1580
Query: 2290 cttaccttgaattcctcgtattctctcttcat 2321
| ||||||||||| || ||||||||||||||
Sbjct: 1579 cgcaccttgaattcttcatattctctcttcat 1548
Score = 42.1 bits (21), Expect = 0.17
Identities = 60/73 (82%)
Strand = Plus / Minus
Query: 862 gaaacgcctccgatgacccagaactgctcgttcctccaccagtcgtcgatggccacgcca 921
||||| ||||| || ||||||||||| || || | |||||| || || ||| ||| |||
Sbjct: 2965 gaaacccctccaataacccagaactgttcatttcgccaccattcttcaatgctcactcca 2906
Query: 922 ctccacctcattt 934
|||||||||||||
Sbjct: 2905 ctccacctcattt 2893
>gb|AY639654.1| Pinus radiata cellulose synthase catalytic subunit (CesA1) mRNA,
complete cds
Length = 3911
Score = 99.6 bits (50), Expect = 8e-019
Identities = 146/178 (82%)
Strand = Plus / Minus
Query: 1237 gcagaacctttgaatgcaggccgcttcgggatgcagtaaatagaccgccagccatggcag 1296
||||| ||||||||||| | || || || || |||||||| ||||||||||| | |
Sbjct: 2606 gcagaccctttgaatgctgctcgtttgggcatacagtaaatggaccgccagcctcgagtg 2547
Query: 1297 tgcatcttaaatccagtcaagatatcctctgtgatcgatccataaatccagccaatctct 1356
|||||||| |||||||||| || |||||||||| |||||||| ||||| |||| ||||
Sbjct: 2546 tgcatcttgaatccagtcagaatgtcctctgtgactgatccatagatccatccaagctct 2487
Query: 1357 tttccccagtcggtcttgtcttcgtagccgcagctgataacatgtatagcttccttca 1414
|||||||| || || |||||||| || || |||||||| ||||| ||||| |||||||
Sbjct: 2486 tttccccattccgttttgtcttcatatccacagctgatgacatgaatagcctccttca 2429
Score = 91.7 bits (46), Expect = 2e-016
Identities = 238/302 (78%)
Strand = Plus / Minus
Query: 1783 catccagtacccacataaatgggcccttgaataccatccaaacctttcatgttgatatca 1842
|||||||| |||||||| | ||||||||||| ||||||| |||||||||||||||||||
Sbjct: 2102 catccagttcccacatatacaggcccttgaattccatccagacctttcatgttgatatca 2043
Query: 1843 aaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaaacctctga 1902
|| || || ||| | || || || || |||| || ||||||||| | || ||||||
Sbjct: 2042 aagaatacggtgtttcgattggcgtaacggtcattgcgatcaataccatcgaatctctga 1983
Query: 1903 gggaactgtacatagcacactttcttccccaccaaaggatccatcatgaaacacatagcc 1962
||||| || ||||| || ||||| |||| ||| |||||||||||| || ||||| |
Sbjct: 1982 gggaattggacataacagacttttctcccaacctgaggatccatcataaagcacatgcct 1923
Query: 1963 tcttttatggccttgctattgttgatgtagtgatcacagtccaagttcaataggtatgca 2022
|| | || |||||||| ||||| |||||||||||||| |||| |||| | ||| |
Sbjct: 1922 tccctgattgccttgctgttgttaatgtagtgatcacaatccagattcagcataaatgga 1863
Query: 2023 gcatttgataagacagcagagacacggaccagtgcattcatggcaccagccttcttgtga 2082
||||| | | |||||||| || || |||| |||||||||||||| ||||||||||||
Sbjct: 1862 gcattggtgagcacagcagaaacccgaaccaaagcattcatggcaccggccttcttgtga 1803
Query: 2083 tg 2084
||
Sbjct: 1802 tg 1801
Score = 61.9 bits (31), Expect = 2e-007
Identities = 46/51 (90%)
Strand = Plus / Minus
Query: 2706 ccactttgggaactgatcaagaatccaggacatcgcaaaccagatttcaca 2756
|||||| || ||||||||||||||||| |||| |||||||||||||||||
Sbjct: 1179 ccacttgggaaactgatcaagaatccatgacaaggcaaaccagatttcaca 1129
Score = 58.0 bits (29), Expect = 3e-006
Identities = 80/97 (82%)
Strand = Plus / Minus
Query: 2230 tcttgcattgtccatccttcctcaggaaccttttgggcttttgcaaccaaggcattgatc 2289
|||||||||||||||||||||| || || || ||| ||||||||||| ||||||
Sbjct: 1655 tcttgcattgtccatccttccttgggcactttagaggcctttgcaaccaaccgattgatg 1596
Query: 2290 cttaccttgaattcctcgtattctctcttcatcgccc 2326
| ||||||||||| || |||||||||||||| ||||
Sbjct: 1595 cgcaccttgaattcttcatattctctcttcatggccc 1559
Score = 56.0 bits (28), Expect = 1e-005
Identities = 61/72 (84%)
Strand = Plus / Minus
Query: 552 gttctgcctccccaccagacccttgaggaacgggtacaggtggacgatcacccagaaggc 611
||||||||| |||| |||||||||||||| || |||||||| || || |||||||| ||
Sbjct: 3291 gttctgcctgcccatgagacccttgaggaaaggatacaggtgcacaatgacccagaatgc 3232
Query: 612 gaagaagagctt 623
||||| |||||
Sbjct: 3231 aaagaaaagctt 3220
Score = 50.1 bits (25), Expect = 7e-004
Identities = 64/77 (83%)
Strand = Plus / Minus
Query: 862 gaaacgcctccgatgacccagaactgctcgttcctccaccagtcgtcgatggccacgcca 921
||||| ||||| || ||||||||||| || || | |||||| || || ||| ||| |||
Sbjct: 2981 gaaacccctccaataacccagaactgttcatttcgccaccattcttcaatgctcactcca 2922
Query: 922 ctccacctcatttccag 938
|||||||||||||||||
Sbjct: 2921 ctccacctcatttccag 2905
>gb|AY789652.1| Pinus taeda cellulose synthase catalytic subunit (CesA3) mRNA,
complete cds
Length = 3959
Score = 99.6 bits (50), Expect = 8e-019
Identities = 146/178 (82%)
Strand = Plus / Minus
Query: 1237 gcagaacctttgaatgcaggccgcttcgggatgcagtaaatagaccgccagccatggcag 1296
||||| ||||||||||| | || || || || |||||||| ||||||||||| | |
Sbjct: 2596 gcagaccctttgaatgctgctcgtttgggcatacagtaaatggaccgccagcctcgagtg 2537
Query: 1297 tgcatcttaaatccagtcaagatatcctctgtgatcgatccataaatccagccaatctct 1356
|||||||| |||||||||| || |||||||||| |||||||| ||||| |||| ||||
Sbjct: 2536 tgcatcttgaatccagtcagaatgtcctctgtgactgatccatagatccatccaagctct 2477
Query: 1357 tttccccagtcggtcttgtcttcgtagccgcagctgataacatgtatagcttccttca 1414
|||||||| || || |||||||| || || |||||||| ||||| ||||| |||||||
Sbjct: 2476 tttccccattccgttttgtcttcatatccacagctgatgacatgaatagcctccttca 2419
Score = 99.6 bits (50), Expect = 8e-019
Identities = 239/302 (79%)
Strand = Plus / Minus
Query: 1783 catccagtacccacataaatgggcccttgaataccatccaaacctttcatgttgatatca 1842
|||||||| |||||||| | ||||||||||| ||||||| |||||||||||||||||||
Sbjct: 2092 catccagttcccacatatacaggcccttgaattccatccagacctttcatgttgatatca 2033
Query: 1843 aaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaaacctctga 1902
|| || || ||| | || || || || |||| || ||||||||| | || ||||||
Sbjct: 2032 aagaatacggtgtttcgattggcgtaacggtcattgcgatcaataccatcgaatctctga 1973
Query: 1903 gggaactgtacatagcacactttcttccccaccaaaggatccatcatgaaacacatagcc 1962
||||| || ||||| || ||||| |||| ||| |||||||||||| || ||||| ||
Sbjct: 1972 gggaattggacataacagacttttctcccaacctgaggatccatcataaagcacatggct 1913
Query: 1963 tcttttatggccttgctattgttgatgtagtgatcacagtccaagttcaataggtatgca 2022
|| | || |||||||| ||||| |||||||||||||| |||| |||| | ||| |
Sbjct: 1912 tccctgattgccttgctgttgttaatgtagtgatcacaatccagattcagcataaatgga 1853
Query: 2023 gcatttgataagacagcagagacacggaccagtgcattcatggcaccagccttcttgtga 2082
||||| | | |||||||| || || |||| |||||||||||||| ||||||||||||
Sbjct: 1852 gcattggtgagcacagcagaaacccgaaccaaagcattcatggcaccggccttcttgtga 1793
Query: 2083 tg 2084
||
Sbjct: 1792 tg 1791
Score = 61.9 bits (31), Expect = 2e-007
Identities = 46/51 (90%)
Strand = Plus / Minus
Query: 2706 ccactttgggaactgatcaagaatccaggacatcgcaaaccagatttcaca 2756
|||||| || ||||||||||||||||| |||| |||||||||||||||||
Sbjct: 1169 ccacttgggaaactgatcaagaatccatgacaaggcaaaccagatttcaca 1119
Score = 58.0 bits (29), Expect = 3e-006
Identities = 80/97 (82%)
Strand = Plus / Minus
Query: 2230 tcttgcattgtccatccttcctcaggaaccttttgggcttttgcaaccaaggcattgatc 2289
|||||||||||||||||||||| || || || ||| ||||||||||| ||||||
Sbjct: 1645 tcttgcattgtccatccttccttgggcactttagaggcctttgcaaccaaccgattgatg 1586
Query: 2290 cttaccttgaattcctcgtattctctcttcatcgccc 2326
| ||||||||||| || |||||||||||||| ||||
Sbjct: 1585 cgcaccttgaattcttcatattctctcttcatggccc 1549
Score = 56.0 bits (28), Expect = 1e-005
Identities = 61/72 (84%)
Strand = Plus / Minus
Query: 552 gttctgcctccccaccagacccttgaggaacgggtacaggtggacgatcacccagaaggc 611
||||||||| |||| |||||||||||||| || |||||||| || || |||||||| ||
Sbjct: 3281 gttctgcctgcccatgagacccttgaggaaaggatacaggtgcacaataacccagaatgc 3222
Query: 612 gaagaagagctt 623
||||| |||||
Sbjct: 3221 aaagaaaagctt 3210
Score = 50.1 bits (25), Expect = 7e-004
Identities = 64/77 (83%)
Strand = Plus / Minus
Query: 862 gaaacgcctccgatgacccagaactgctcgttcctccaccagtcgtcgatggccacgcca 921
||||| ||||| || ||||||||||| || || | |||||| || || ||| ||| |||
Sbjct: 2971 gaaacccctccaataacccagaactgttcatttcgccaccattcttcaatgctcactcca 2912
Query: 922 ctccacctcatttccag 938
|||||||||||||||||
Sbjct: 2911 ctccacctcatttccag 2895
>gb|BI202889.1|BI202889 NXPV_091_H09_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_091_H09 5' similar to Arabidopsis
thaliana sequence At5g05170 cellulose synthase catalytic
subunit (Ath-B) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 537
Score = 93.7 bits (47), Expect = 5e-017
Identities = 101/119 (84%)
Strand = Plus / Minus
Query: 1296 gtgcatcttaaatccagtcaagatatcctctgtgatcgatccataaatccagccaatctc 1355
||||||||| |||||||||| || |||||||||| |||||||| ||||| |||| |||
Sbjct: 250 gtgcatcttgaatccagtcagaatgtcctctgtgactgatccatagatccatccaagctc 191
Query: 1356 ttttccccagtcggtcttgtcttcgtagccgcagctgataacatgtatagcttccttca 1414
||||||||| || || |||||||| || || |||||||| ||||| ||||| |||||||
Sbjct: 190 ttttccccattccgttttgtcttcatatccacagctgatgacatgaatagcctccttca 132
>gb|AW056552.1|AW056552 ST51E06 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST51E06, mRNA sequence
Length = 389
Score = 91.7 bits (46), Expect = 2e-016
Identities = 86/100 (86%)
Strand = Plus / Minus
Query: 1264 gggatgcagtaaatagaccgccagccatggcagtgcatcttaaatccagtcaagatatcc 1323
||||| ||||||||||| ||||| |||||||||||||| || || |||||||| ||||||
Sbjct: 100 gggatacagtaaatagaacgccatccatggcagtgcattttgaaaccagtcaaaatatcc 41
Query: 1324 tctgtgatcgatccataaatccagccaatctcttttcccc 1363
||||||| || ||||| ||||| |||| ||||||||||
Sbjct: 40 tctgtgactgaaccatatatccacccaanntcttttcccc 1
>gb|AY262820.1| Pinus radiata cellulose synthase (CesA10) mRNA, complete cds
Length = 4428
Score = 91.7 bits (46), Expect = 2e-016
Identities = 154/190 (81%)
Strand = Plus / Minus
Query: 1775 tgaaaacacatccagtacccacataaatgggcccttgaataccatccaaacctttcatgt 1834
||||||| || || || |||||||||| ||||| || || ||||||||||| |||| |
Sbjct: 2617 tgaaaacgcaccctgtgcccacataaacaggcccctgtatcccatccaaacccttcaaat 2558
Query: 1835 tgatatcaaaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaa 1894
|||||||||||||||| || |||||||||||||||| | |||||| ||| |||
Sbjct: 2557 tgatatcaaaaaagactgtattgtgattagcatatcgatcatttctgtcaatgccatcaa 2498
Query: 1895 acctctgagggaactgtacatagcacactttcttccccaccaaaggatccatcatgaaac 1954
|||| ||||||||||| ||||| || ||||||||||| | |||||||||||| ||||
Sbjct: 2497 acctttgagggaactgaacataacagactttcttcccaagagtaggatccatcataaaac 2438
Query: 1955 acatagcctc 1964
|||| |||||
Sbjct: 2437 acatggcctc 2428
Score = 81.8 bits (41), Expect = 2e-013
Identities = 95/113 (84%)
Strand = Plus / Minus
Query: 2437 acccatttctttgcaaattcagatgtttcagacaatgcttcaaacgtaagcattgcagca 2496
||||||||| |||||||||| || |||||||| | |||||||| || |||||||||||
Sbjct: 1955 acccatttccttgcaaattctgaggtttcagaaagggcttcaaatgttagcattgcagct 1896
Query: 2497 ccatcatcagaaacatagcaggagaccttctcaaccggataatccacagaaag 2549
||||| ||||| ||||| || || || || ||||| ||||| |||||||||||
Sbjct: 1895 ccatcgtcagacacataacatgaaactttatcaactggatagtccacagaaag 1843
Score = 73.8 bits (37), Expect = 5e-011
Identities = 94/113 (83%)
Strand = Plus / Minus
Query: 1297 tgcatcttaaatccagtcaagatatcctctgtgatcgatccataaatccagccaatctct 1356
||||| ||||| |||||||| ||||| ||||| | || ||||| ||||| |||||||||
Sbjct: 3059 tgcattttaaagccagtcaaaatatcttctgtcacagaaccatatatccaaccaatctct 3000
Query: 1357 tttccccagtcggtcttgtcttcgtagccgcagctgataacatgtatagcttc 1409
|||||||| || | ||||||||| || || |||||||| ||||| || |||||
Sbjct: 2999 tttccccaatctgacttgtcttcataaccacagctgattacatggattgcttc 2947
Score = 73.8 bits (37), Expect = 5e-011
Identities = 94/113 (83%)
Strand = Plus / Minus
Query: 2209 tttccaggccaggggcttccatcttgcattgtccatccttcctcaggaaccttttgggct 2268
||||||||||| || ||||||||||||| |||| ||||| ||||||||||| || |||
Sbjct: 2183 tttccaggccaaggtgttccatcttgcataatccagccttcttcaggaaccttctgagct 2124
Query: 2269 tttgcaaccaaggcattgatccttaccttgaattcctcgtattctctcttcat 2321
|| ||||| | |||||||| | |||||||| || || ||||||||||||||
Sbjct: 2123 ttagcaacaagagcattgattcggaccttgaactcttcatattctctcttcat 2071
Score = 60.0 bits (30), Expect = 7e-007
Identities = 54/62 (87%)
Strand = Plus / Minus
Query: 2701 ggaagccactttgggaactgatcaagaatccaggacatcgcaaaccagatttcacagatt 2760
|||||||| || || |||||||||||||||||||| || |||||||| || ||||| |||
Sbjct: 1691 ggaagccatttaggaaactgatcaagaatccaggatatggcaaaccaaatctcacatatt 1632
Query: 2761 ac 2762
||
Sbjct: 1631 ac 1630
Score = 46.1 bits (23), Expect = 0.011
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 868 cctccgatgacccagaactgctcgttcctccacca 902
||||| || |||||||||||||| |||||||||||
Sbjct: 3488 cctccaatcacccagaactgctcattcctccacca 3454
>gb|AY789650.1| Pinus taeda cellulose synthase catalytic subunit (CesA1) mRNA,
complete cds
Length = 3127
Score = 89.7 bits (45), Expect = 8e-016
Identities = 234/297 (78%)
Strand = Plus / Minus
Query: 1782 acatccagtacccacataaatgggcccttgaataccatccaaacctttcatgttgatatc 1841
|||||||||||||||||| | |||||||| || |||||||| || ||||||||||||||
Sbjct: 1650 acatccagtacccacatacactggcccttggatgccatccaatcccttcatgttgatatc 1591
Query: 1842 aaaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaaacctctg 1901
|| || ||| ||| | || ||||||||||| || || |||||| | ||||||||
Sbjct: 1590 gaagaacacagtgtttcgattggcatatcgatcgctgcgatcgataccatcgaacctctg 1531
Query: 1902 agggaactgtacatagcacactttcttccccaccaaaggatccatcatgaaacacatagc 1961
|||||||| || |||||||| ||| | || ||| |||||||||||| || | ||| ||
Sbjct: 1530 tgggaactgcacgtagcacacgttccttccaacctcaggatccatcataaagcgcattgc 1471
Query: 1962 ctcttttatggccttgctattgttgatgtagtgatcacagtccaagttcaataggtatgc 2021
|| | ||||||||| || || | |||||||||||| |||||||||| |||||||
Sbjct: 1470 ttcgcgaacggccttgctgttattaacgtagtgatcacaatccaagttcagcaggtatgg 1411
Query: 2022 agcatttgataagacagcagagacacggaccagtgcattcatggcaccagccttctt 2078
|| || | | || |||||||| || |||| ||||||||||||||| ||||||||
Sbjct: 1410 ggcgttcgtcagtacggcagagactcgaaccaatgcattcatggcaccggccttctt 1354
Score = 81.8 bits (41), Expect = 2e-013
Identities = 203/257 (78%)
Strand = Plus / Minus
Query: 1153 gggcagtgcttgctgaagaaaatttcgacagacccaagggcccagcgaaggacctggtga 1212
||||||||| ||||||| || ||||| | ||| || | ||||| ||||| || |||||
Sbjct: 2240 gggcagtgcctgctgaataagatttcaatagaacccaatgcccaacgaagaacttggtgc 2181
Query: 1213 agacggtcggaaaggttcagaggcgcagaacctttgaatgcaggccgcttcgggatgcag 1272
||||| || || || || | ||| ||||| || |||||||| || | ||| || ||||||
Sbjct: 2180 agacgatctgatagattgataggagcagaccccttgaatgctggtctcttgggcatgcag 2121
Query: 1273 taaatagaccgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatc 1332
||||| || ||||| || ||||||||||||| || || || | || || ||||| |
Sbjct: 2120 taaatggagcgccaccctcggcagtgcatcttgaaacctgttagaatgtcttctgtcaca 2061
Query: 1333 gatccataaatccagccaatctcttttccccagtcggtcttgtcttcgtagccgcagctg 1392
|| ||||| ||||| || | |||||| ||||| ||||| || ||||||||||| ||||||
Sbjct: 2060 gaaccatagatccatccgacctctttcccccattcggttttctcttcgtagccacagctg 2001
Query: 1393 ataacatgtatagcttc 1409
|| ||||||||||||||
Sbjct: 2000 atcacatgtatagcttc 1984
Score = 69.9 bits (35), Expect = 8e-010
Identities = 122/151 (80%)
Strand = Plus / Minus
Query: 2395 tcaggagcacgaggctcgatattaaactttttgctgaaaggaacccatttctttgcaaat 2454
|||||||| ||||||||||| ||||| || |||| |||||||||||| ||| | || ||
Sbjct: 1037 tcaggagctcgaggctcgatgttaaagttcttgcagaaaggaacccacttcctagcgaac 978
Query: 2455 tcagatgtttcagacaatgcttcaaacgtaagcattgcagcaccatcatcagaaacatag 2514
|||| ||| || |||| | || ||||| ||||| || |||||||| ||||| ||||||
Sbjct: 977 tcagctgtctccgacatggtctcgaacgtgagcatggccgcaccatcgtcagagacatag 918
Query: 2515 caggagaccttctcaaccggataatccacag 2545
|| || || ||||| || || ||||||||||
Sbjct: 917 caagaaactttctccacagggtaatccacag 887
Score = 56.0 bits (28), Expect = 1e-005
Identities = 70/84 (83%)
Strand = Plus / Minus
Query: 868 cctccgatgacccagaactgctcgttcctccaccagtcgtcgatggccacgccactccac 927
||||| || ||||| ||||| |||||||||||||| || |||||| ||| ||||||||
Sbjct: 2528 cctccaatcacccaaaactgttcgttcctccaccattcttcgatgctcactccactccat 2469
Query: 928 ctcatttccaggatgccggtcacg 951
|||| |||||| | ||| ||||||
Sbjct: 2468 ctcagttccagaacgcccgtcacg 2445
Score = 46.1 bits (23), Expect = 0.011
Identities = 44/51 (86%)
Strand = Plus / Minus
Query: 2706 ccactttgggaactgatcaagaatccaggacatcgcaaaccagatttcaca 2756
|||||| || |||||||||||||||||||| | || |||||||| |||||
Sbjct: 726 ccacttgggaaactgatcaagaatccaggataaagcgaaccagatctcaca 676
Score = 44.1 bits (22), Expect = 0.043
Identities = 118/150 (78%)
Strand = Plus / Minus
Query: 2172 gaatacctgaatcattccaggatgatcgcgtacgttgtttccaggccaggggcttccatc 2231
||||||||||||||| || || ||||| || |||||| |||||||| | |||||||
Sbjct: 1260 gaatacctgaatcatcccggggtgatcacgagtgttgttcccaggccaagctgttccatc 1201
Query: 2232 ttgcattgtccatccttcctcaggaaccttttgggcttttgcaaccaaggcattgatcct 2291
||||| |||||||||| || || ||| || ||||| || || | |||||||||||
Sbjct: 1200 ctgcatgatccatccttcgtccggtgtcttctgagctttggcgacaagcgcattgatcct 1141
Query: 2292 taccttgaattcctcgtattctctcttcat 2321
|| ||| |||||||||| ||||| |||||
Sbjct: 1140 aactttgtattcctcgtactctcttttcat 1111
>gb|BX249248.1|BX249248 BX249248 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP021G11 similar to Cellulose synthase
catalytic subunit, mRNA sequence
Length = 708
Score = 87.7 bits (44), Expect = 3e-015
Identities = 113/136 (83%)
Strand = Plus / Minus
Query: 1775 tgaaaacacatccagtacccacataaatgggcccttgaataccatccaaacctttcatgt 1834
||||||| |||||||| |||||||| | ||||| || || ||||| | ||| |||||||
Sbjct: 139 tgaaaacgcatccagtccccacatacactggcccctggatgccatctagacccttcatgt 80
Query: 1835 tgatatcaaaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaa 1894
||||||| || || ||| ||| ||||| |||||||||||||| || ||||||||| | |
Sbjct: 79 tgatatcgaagaaaacagtgtttctgtttgcatatcgatcatggcgatcaataccatcga 20
Query: 1895 acctctgagggaactg 1910
| ||||||||||||||
Sbjct: 19 atctctgagggaactg 4
Score = 48.1 bits (24), Expect = 0.003
Identities = 106/132 (80%), Gaps = 1/132 (0%)
Strand = Plus / Minus
Query: 1282 cgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatcgat-ccata 1340
||||| ||| |||||||||| || || || |||| |||||||||||| | || |||||
Sbjct: 628 cgccaaccacggcagtgcattttgaagcctgtcaggatatcctctgtcactgaaaccata 569
Query: 1341 aatccagccaatctcttttccccagtcggtcttgtcttcgtagccgcagctgataacatg 1400
||||| || ||||| |||||||| || || || || ||||| ||||||||||| || ||
Sbjct: 568 tatccatccgatctcctttccccattcagttttctcctcgtatccgcagctgatgacgtg 509
Query: 1401 tatagcttcctt 1412
|| ||||||||
Sbjct: 508 aatggcttcctt 497
>gb|DR101934.1|DR101934 STRR1_76_G04.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_76_G04_A033 5', mRNA sequence
Length = 579
Score = 87.7 bits (44), Expect = 3e-015
Identities = 170/212 (80%)
Strand = Plus / Minus
Query: 1747 gcatcataaccatatagtgcctgccgtctgaaaacacatccagtacccacataaatgggc 1806
|||||||| ||||| || || || | || ||||||||| || ||||| ||||| || ||
Sbjct: 222 gcatcatatccatagagagcttgtcttcggaaaacacaacctgtaccaacatatataggt 163
Query: 1807 ccttgaataccatccaaacctttcatgttgatatcaaaaaagacaacgttcctgttagca 1866
|| || || ||||||| |||||||||||| |||||||| || ||| || | || |||
Sbjct: 162 ccctgtattccatccagacctttcatgtttatatcaaagaacacagtattgcgattggca 103
Query: 1867 tatcgatcatgacggtcaataccaccaaacctctgagggaactgtacatagcacactttc 1926
|||| |||||| | ||||||||| ||||||||||||||||||| |||||||| || |||
Sbjct: 102 tatctatcatgccaatcaataccatcaaacctctgagggaactgcacatagcagaccttc 43
Query: 1927 ttccccaccaaaggatccatcatgaaacacat 1958
|| |||| |||||||||||||||||||
Sbjct: 42 tttcccaatgtgtgatccatcatgaaacacat 11
>gb|BG275715.1|BG275715 NXSI_145_B01_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_145_B01 5' similar to Arabidopsis thaliana
sequence At4g18780 cellulose synthase catalytic subunit
(IRX1) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 487
Score = 85.7 bits (43), Expect = 1e-014
Identities = 190/239 (79%)
Strand = Plus / Minus
Query: 1782 acatccagtacccacataaatgggcccttgaataccatccaaacctttcatgttgatatc 1841
|||||||||||||||||| | |||||||| || |||||||| || ||||||||||||||
Sbjct: 269 acatccagtacccacatacactggcccttggatgccatccaatcccttcatgttgatatc 210
Query: 1842 aaaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaaacctctg 1901
|| || ||| ||| | || ||||||||||| || || |||||| | ||||||||
Sbjct: 209 gaagaacacagtgtttcgattggcatatcgatcgctgcgatcgataccatcgaacctctg 150
Query: 1902 agggaactgtacatagcacactttcttccccaccaaaggatccatcatgaaacacatagc 1961
|||||||| || |||||||| ||| | || ||| |||||||||||| || ||||| ||
Sbjct: 149 tgggaactgcacgtagcacacgttccttccaacctcaggatccatcataaagcacattgc 90
Query: 1962 ctcttttatggccttgctattgttgatgtagtgatcacagtccaagttcaataggtatg 2020
|| | ||||||||| || || | |||||||||||| |||||||||| |||||||
Sbjct: 89 ttcgcgaacggccttgctgttattaacgtagtgatcacaatccaagttcagcaggtatg 31
>gb|DR059426.1|DR059426 RTNIT1_17_D03.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_17_D03_A029 5', mRNA sequence
Length = 862
Score = 83.8 bits (42), Expect = 5e-014
Identities = 183/230 (79%)
Strand = Plus / Minus
Query: 2386 aagtaccactcaggagcacgaggctcgatattaaactttttgctgaaaggaacccatttc 2445
||||||||||| ||||| | || || || ||||||||||||| || || |||||||||
Sbjct: 319 aagtaccactctggagctctgggttcaatgttaaactttttgcaaaatggcacccatttc 260
Query: 2446 tttgcaaattcagatgtttcagacaatgcttcaaacgtaagcattgcagcaccatcatca 2505
|||||||||| || ||||| || | | ||| || || | ||| || || ||||| |||
Sbjct: 259 cttgcaaattctgaagtttctgaaagggattcgaaagtcaacatggctgctccatcgtca 200
Query: 2506 gaaacatagcaggagaccttctcaaccggataatccacagaaaggatggaaaggacagtg 2565
|||||||||||||| ||||| ||||| |||||||||||||| || || || || ||||||
Sbjct: 199 gaaacatagcaggaaaccttgtcaacaggataatccacagacagaatcgacagaacagtg 140
Query: 2566 ttcgctgtgaccaagggaggttcctttgtgggatcaaccgtactgacaaa 2615
|| || || || | ||||| |||||| || ||||| |||||||||||
Sbjct: 139 tttgcagtaacaagaggaggctcctttaaagggtcaactgtactgacaaa 90
Score = 65.9 bits (33), Expect = 1e-008
Identities = 99/121 (81%)
Strand = Plus / Minus
Query: 2209 tttccaggccaggggcttccatcttgcattgtccatccttcctcaggaaccttttgggct 2268
|||||||||||| | | ||||||||||| ||| || || ||||| ||||| |||||
Sbjct: 496 tttccaggccagagagtgccatcttgcataacccagccctcttcaggtaccttctgggcc 437
Query: 2269 tttgcaaccaaggcattgatccttaccttgaattcctcgtattctctcttcatcgccctc 2328
|| ||||| | |||||||||| ||||||||||| || |||||||||||||| ||||||
Sbjct: 436 ttcgcaacaagcgcattgatccgaaccttgaattcttcatattctctcttcattgccctc 377
Query: 2329 c 2329
|
Sbjct: 376 c 376
>gb|AW985306.1|AW985306 NXNV_135_F04_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_135_F04 5' similar to Arabidopsis thaliana sequence
At5g44030 cellulose synthase catalytic subunit-like
protein see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 418
Score = 81.8 bits (41), Expect = 2e-013
Identities = 117/143 (81%)
Strand = Plus / Minus
Query: 1775 tgaaaacacatccagtacccacataaatgggcccttgaataccatccaaacctttcatgt 1834
||||||| |||||||| |||||||| | ||||| || || ||||| | ||| |||||||
Sbjct: 143 tgaaaacgcatccagtccccacatacactggcccctggatgccatctagacccttcatgt 84
Query: 1835 tgatatcaaaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaa 1894
||||||| || || ||| ||| ||||| |||||||||||||| || ||||||||| | |
Sbjct: 83 tgatatcgaagaaaacagtgtttctgtttgcatatcgatcatggcgatcaataccatcga 24
Query: 1895 acctctgagggaactgtacatag 1917
| |||||||||||| ||||||
Sbjct: 23 atnnctgagggaactgaacatag 1
>gb|CF672886.1|CF672886 RTCNT1_74_D05.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_74_D05_A029 5', mRNA sequence
Length = 763
Score = 81.8 bits (41), Expect = 2e-013
Identities = 203/257 (78%)
Strand = Plus / Minus
Query: 1153 gggcagtgcttgctgaagaaaatttcgacagacccaagggcccagcgaaggacctggtga 1212
||||||||| ||||||| || ||||| | ||| || | ||||| ||||| || |||||
Sbjct: 498 gggcagtgcctgctgaataagatttcaatagaacccaatgcccaacgaagaacttggtgc 439
Query: 1213 agacggtcggaaaggttcagaggcgcagaacctttgaatgcaggccgcttcgggatgcag 1272
||||| || || || || | ||| ||||| || |||||||| || | ||| || ||||||
Sbjct: 438 agacgatctgatagattgataggagcagaccccttgaatgctggtctcttgggcatgcag 379
Query: 1273 taaatagaccgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatc 1332
||||| || ||||| || ||||||||||||| || || || | || || ||||| |
Sbjct: 378 taaatggagcgccatcctcggcagtgcatcttgaaacctgttagaatgtcttctgtcaca 319
Query: 1333 gatccataaatccagccaatctcttttccccagtcggtcttgtcttcgtagccgcagctg 1392
|| ||||| ||||| || | |||||| ||||| ||||| || ||||||||||| ||||||
Sbjct: 318 gaaccatagatccatccgacctctttcccccattcggttttctcttcgtagccacagctg 259
Query: 1393 ataacatgtatagcttc 1409
|| ||||||||||||||
Sbjct: 258 atcacatgtatagcttc 242
Score = 42.1 bits (21), Expect = 0.17
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 891 gttcctccaccagtcgtcgatggccacgccactccacctcatttccaggatgccggtcac 950
|||||||||||| || |||||| ||| |||||||| |||| |||||| | ||| |||||
Sbjct: 763 gttcctccaccattcttcgatgctcactccactccatctcagttccagaacgcccgtcac 704
Query: 951 g 951
|
Sbjct: 703 g 703
>gb|DR054410.1|DR054410 RTCA1_17_D10.b1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_17_D10_A029 3', mRNA sequence
Length = 821
Score = 81.8 bits (41), Expect = 2e-013
Identities = 203/257 (78%)
Strand = Plus / Plus
Query: 1153 gggcagtgcttgctgaagaaaatttcgacagacccaagggcccagcgaaggacctggtga 1212
||||||||| ||||||| || ||||| | ||| || | ||||| ||||| || |||||
Sbjct: 453 gggcagtgcctgctgaataagatttcaatagaacccaatgcccaacgaagaacttggtgc 512
Query: 1213 agacggtcggaaaggttcagaggcgcagaacctttgaatgcaggccgcttcgggatgcag 1272
||||| || || || || | ||| ||||| || |||||||| || | ||| || ||||||
Sbjct: 513 agacgatctgatagattgataggagcagaccccttgaatgctggtctcttgggcatgcag 572
Query: 1273 taaatagaccgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatc 1332
||||| || ||||| || ||||||||||||| || || || | || || ||||| |
Sbjct: 573 taaatggagcgccatcctcggcagtgcatcttgaaacctgttagaatgtcttctgtcaca 632
Query: 1333 gatccataaatccagccaatctcttttccccagtcggtcttgtcttcgtagccgcagctg 1392
|| ||||| ||||| || | |||||| ||||| ||||| || ||||||||||| ||||||
Sbjct: 633 gaaccatagatccatccgacctctttcccccattcggttttctcttcgtagccacagctg 692
Query: 1393 ataacatgtatagcttc 1409
|| ||||||||||||||
Sbjct: 693 atcacatgtatagcttc 709
Score = 56.0 bits (28), Expect = 1e-005
Identities = 70/84 (83%)
Strand = Plus / Plus
Query: 868 cctccgatgacccagaactgctcgttcctccaccagtcgtcgatggccacgccactccac 927
||||| || ||||| ||||| |||||||||||||| || |||||| ||| ||||||||
Sbjct: 165 cctccaatcacccaaaactgttcgttcctccaccattcttcgatgctcactccactccat 224
Query: 928 ctcatttccaggatgccggtcacg 951
|||| |||||| | ||| ||||||
Sbjct: 225 ctcagttccagaacgcccgtcacg 248
>gb|DR110920.1|DR110920 RTS1_14_B08.b1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_14_B08_A029 3', mRNA sequence
Length = 632
Score = 81.8 bits (41), Expect = 2e-013
Identities = 203/257 (78%)
Strand = Plus / Plus
Query: 1153 gggcagtgcttgctgaagaaaatttcgacagacccaagggcccagcgaaggacctggtga 1212
||||||||| ||||||| || ||||| | ||| || | ||||| ||||| || |||||
Sbjct: 247 gggcagtgcctgctgaataagatttcaatagaacccaatgcccaacgaagaacttggtgc 306
Query: 1213 agacggtcggaaaggttcagaggcgcagaacctttgaatgcaggccgcttcgggatgcag 1272
||||| || || || || | ||| ||||| || |||||||| || | ||| || ||||||
Sbjct: 307 agacgatctgatagattgataggagcagaccccttgaatgctggtctcttgggcatgcag 366
Query: 1273 taaatagaccgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatc 1332
||||| || ||||| || ||||||||||||| || || || | || || ||||| |
Sbjct: 367 taaatggagcgccaccctcggcagtgcatcttgaaacctgttagaatgtcttctgtcaca 426
Query: 1333 gatccataaatccagccaatctcttttccccagtcggtcttgtcttcgtagccgcagctg 1392
|| ||||| ||||| || | |||||| ||||| ||||| || ||||||||||| ||||||
Sbjct: 427 gaaccatagatccatccgacctctttcccccattcggttttctcttcgtagccacagctg 486
Query: 1393 ataacatgtatagcttc 1409
|| ||||||||||||||
Sbjct: 487 atcacatgtatagcttc 503
>dbj|BD235989.1| Materials and method for modification of plant cell wall
polysaccharides
Length = 619
Score = 81.8 bits (41), Expect = 2e-013
Identities = 203/257 (78%)
Strand = Plus / Minus
Query: 1153 gggcagtgcttgctgaagaaaatttcgacagacccaagggcccagcgaaggacctggtga 1212
||||||||| ||||||| || ||||| | ||| || | ||||| ||||| || |||||
Sbjct: 378 gggcagtgcctgctgaataagatttcaatagaacccaatgcccaacgaagaacttggtgc 319
Query: 1213 agacggtcggaaaggttcagaggcgcagaacctttgaatgcaggccgcttcgggatgcag 1272
||||| || || || || | ||| ||||| || |||||||| || | ||| || ||||||
Sbjct: 318 agacgatctgatagattgataggagcagaccccttgaatgctggtctcttgggcatgcag 259
Query: 1273 taaatagaccgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatc 1332
||||| || ||||| || ||||||||||||| || || || | || || ||||| |
Sbjct: 258 taaatggagcgccatcctcggcagtgcatcttgaaacctgttagaatgtcttctgtcaca 199
Query: 1333 gatccataaatccagccaatctcttttccccagtcggtcttgtcttcgtagccgcagctg 1392
|| ||||| ||||| || | |||||| ||||| ||||| || ||||||||||| ||||||
Sbjct: 198 gaaccatagatccatccgacctctttcccccattcggttttctcttcgtagccacagctg 139
Query: 1393 ataacatgtatagcttc 1409
|| ||||||||||||||
Sbjct: 138 atcacatgtatagcttc 122
>gb|AW984889.1|AW984889 NXNV_100_C02_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_100_C02 5' similar to Arabidopsis thaliana sequence
At5g05170 cellulose synthase catalytic subunit (Ath-B)
see http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 405
Score = 75.8 bits (38), Expect = 1e-011
Identities = 98/119 (82%)
Strand = Plus / Minus
Query: 1296 gtgcatcttaaatccagtcaagatatcctctgtgatcgatccataaatccagccaatctc 1355
||||||||| |||||||||| || | |||||| |||||||| ||||| |||| |||
Sbjct: 305 gtgcatcttgaatccagtcagaatgtnnnctgtgactgatccatagatccatccaagctc 246
Query: 1356 ttttccccagtcggtcttgtcttcgtagccgcagctgataacatgtatagcttccttca 1414
||||||||| || || |||||||| || || |||||||| ||||| ||||| |||||||
Sbjct: 245 ttttccccattccgttttgtcttcatatccacagctgatgacatgaatagcctccttca 187
>gb|BE996873.1|BE996873 NXCI_103_E08_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda
cDNA clone NXCI_103_E08 5' similar to Arabidopsis
thaliana sequence At5g44030 cellulose synthase catalytic
subunit-like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 363
Score = 75.8 bits (38), Expect = 1e-011
Identities = 173/218 (79%)
Strand = Plus / Minus
Query: 1192 gcccagcgaaggacctggtgaagacggtcggaaaggttcagaggcgcagaacctttgaat 1251
||||| ||||| || ||||| ||||| || || || || | ||| ||||| || ||||||
Sbjct: 251 gcccaacgaagaacttggtgcagacgatctgatagattgataggagcagaccccttgaat 192
Query: 1252 gcaggccgcttcgggatgcagtaaatagaccgccagccatggcagtgcatcttaaatcca 1311
|| || | ||| || ||||||||||| || ||||| || ||||||||||||| || ||
Sbjct: 191 gctggtctcttgggcatgcagtaaatggagcgccaccctcggcagtgcatcttgaaacct 132
Query: 1312 gtcaagatatcctctgtgatcgatccataaatccagccaatctcttttccccagtcggtc 1371
|| | || || ||||| | || ||||| ||||| || | |||||| ||||| |||||
Sbjct: 131 gttagaatgtcttctgtcacagaaccatagatccatccgacctctttcccccattcggtt 72
Query: 1372 ttgtcttcgtagccgcagctgataacatgtatagcttc 1409
|| ||||||||||| |||||||| ||||||||||||||
Sbjct: 71 ttctcttcgtagccacagctgatcacatgtatagcttc 34
>gb|CD024597.1|CD024597 NXRV056_C03_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV056_C03 5' similar to Arabidopsis thaliana
sequence At5g17420 cellulose synthase catalytic subunit
(IRX3) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 190
Score = 75.8 bits (38), Expect = 1e-011
Identities = 56/62 (90%)
Strand = Plus / Minus
Query: 1783 catccagtacccacataaatgggcccttgaataccatccaaacctttcatgttgatatca 1842
|||||||| |||||||| | ||||||||||| ||||||| |||||||||||||||||||
Sbjct: 83 catccagttcccacatatacaggcccttgaattccatccagacctttcatgttgatatca 24
Query: 1843 aa 1844
||
Sbjct: 23 aa 22
>gb|CO169549.1|CO169549 NDL1_7_F09.g1_A029 Needles control Pinus taeda cDNA clone
NDL1_7_F09_A029 5', mRNA sequence
Length = 802
Score = 75.8 bits (38), Expect = 1e-011
Identities = 200/254 (78%)
Strand = Plus / Minus
Query: 1153 gggcagtgcttgctgaagaaaatttcgacagacccaagggcccagcgaaggacctggtga 1212
||||||||| ||||||| || ||||| | ||| || | ||||| ||||| || |||||
Sbjct: 256 gggcagtgcctgctgaataagatttcaatagaacccaatgcccaacgaagaacttggtgc 197
Query: 1213 agacggtcggaaaggttcagaggcgcagaacctttgaatgcaggccgcttcgggatgcag 1272
||||| || || || || | ||| ||||| || |||||||| || | ||| || ||||||
Sbjct: 196 agacgatctgatagattgataggagcagaccccttgaatgctggtctcttgggcatgcag 137
Query: 1273 taaatagaccgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatc 1332
||||| || ||||| || ||||||||||||| || || || | || || ||||| |
Sbjct: 136 taaatggagcgccatcctcggcagtgcatcttgaaacctgttagaatgtcttctgtcaca 77
Query: 1333 gatccataaatccagccaatctcttttccccagtcggtcttgtcttcgtagccgcagctg 1392
|| ||||| ||||| || | |||||| ||||| ||||| || ||||||||||| ||||||
Sbjct: 76 gaaccatagatccatccgacctctttcccccattcggttttctcttcgtagccacagctg 17
Query: 1393 ataacatgtatagc 1406
|| |||||||||||
Sbjct: 16 atcacatgtatagc 3
Score = 56.0 bits (28), Expect = 1e-005
Identities = 70/84 (83%)
Strand = Plus / Minus
Query: 868 cctccgatgacccagaactgctcgttcctccaccagtcgtcgatggccacgccactccac 927
||||| || ||||| ||||| |||||||||||||| || |||||| ||| ||||||||
Sbjct: 544 cctccaatcacccaaaactgttcgttcctccaccattcttcgatgctcactccactccat 485
Query: 928 ctcatttccaggatgccggtcacg 951
|||| |||||| | ||| ||||||
Sbjct: 484 ctcagttccagaacgcccgtcacg 461
>gb|DR118589.1|DR118589 RTMG1_18_A07.b1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_18_A07_A029 3', mRNA sequence
Length = 610
Score = 75.8 bits (38), Expect = 1e-011
Identities = 129/158 (81%), Gaps = 1/158 (0%)
Strand = Plus / Plus
Query: 1237 gcagaacctttgaatgcaggccgcttcgggatgcagtaaatagaccgccagccatggcag 1296
||||| ||||||||||| | || || || || |||||||| ||||||||||| | |
Sbjct: 450 gcagaccctttgaatgctgctcgtttgggcatacagtaaatggaccgccagcctcgagtg 509
Query: 1297 tgcatcttaaatccagtcaagatatcctctgtgatcgatccataaatccagccaatctct 1356
|||||||| |||||||||| || |||||||||| |||||||| ||||| |||| ||||
Sbjct: 510 tgcatcttgaatccagtcagaatgtcctctgtgactgatccatagatccatccaagctct 569
Query: 1357 tttccccagtcggtcttgtcttcgtagccgcagctgat 1394
|||||||| || || |||||||| || || ||||||||
Sbjct: 570 tttccccattccgt-ttgtcttcatatccacagctgat 606
Score = 50.1 bits (25), Expect = 7e-004
Identities = 64/77 (83%)
Strand = Plus / Plus
Query: 862 gaaacgcctccgatgacccagaactgctcgttcctccaccagtcgtcgatggccacgcca 921
||||| ||||| || ||||||||||| || || | |||||| || || ||| ||| |||
Sbjct: 75 gaaacccctccaataacccagaactgttcatttcgccaccattcttcaatgctcactcca 134
Query: 922 ctccacctcatttccag 938
|||||||||||||||||
Sbjct: 135 ctccacctcatttccag 151
>gb|BX250234.1|BX250234 BX250234 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP034A11, mRNA sequence
Length = 689
Score = 71.9 bits (36), Expect = 2e-010
Identities = 78/92 (84%)
Strand = Plus / Minus
Query: 1270 cagtaaatagaccgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtg 1329
|||||||| ||||||||||| | | ||||||||| |||||||||| || |||||||||
Sbjct: 92 cagtaaatggaccgccagcctcgactgtgcatcttgaatccagtcagaatgtcctctgtg 33
Query: 1330 atcgatccataaatccagccaatctcttttcc 1361
| |||||||| ||||| |||| |||||||||
Sbjct: 32 actgatccatagatccatccaagctcttttcc 1
Score = 50.1 bits (25), Expect = 7e-004
Identities = 64/77 (83%)
Strand = Plus / Minus
Query: 862 gaaacgcctccgatgacccagaactgctcgttcctccaccagtcgtcgatggccacgcca 921
||||| ||||| || ||||||||||| || || | |||||| || || ||| ||| |||
Sbjct: 500 gaaacccctccaataacccagaactgttcatttcgccaccattcttcaatgctcactcca 441
Query: 922 ctccacctcatttccag 938
|||||||||||||||||
Sbjct: 440 ctccacctcatttccag 424
>gb|BX252761.1|BX252761 BX252761 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP070C12 similar to Cellulose synthase
catalytic subunit, mRNA sequence
Length = 650
Score = 71.9 bits (36), Expect = 2e-010
Identities = 120/148 (81%)
Strand = Plus / Minus
Query: 499 gagaagatcgaggccagcaggatggaccagacgatgacgatcgtcggcgtcctgttctgc 558
||||| || ||||||||||| || ||||| | || || || || ||||| |||||||||
Sbjct: 451 gagaaaatggaggccagcagaatagaccacaatatcactatagtgggcgttctgttctgc 392
Query: 559 ctccccaccagacccttgaggaacgggtacaggtggacgatcacccagaaggcgaagaag 618
|| |||| |||||||||||||| || ||||| || | ||||||||| ||||||||||
Sbjct: 391 cttcccagaagacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaat 332
Query: 619 agcttcccgaacagggggccccacgact 646
||||| || || ||||| ||||| ||||
Sbjct: 331 agctttccaaagaggggtccccatgact 304
Score = 44.1 bits (22), Expect = 0.043
Identities = 64/78 (82%)
Strand = Plus / Minus
Query: 822 caccttcagcaggccctggaacaccgcgaacagatgcgccgaaacgcctccgatgaccca 881
|||||| |||||||| || || || || || ||||| || || || ||||| ||||||||
Sbjct: 125 caccttgagcaggccttgaaaaacagcaaaaagatgagcagagacccctccaatgaccca 66
Query: 882 gaactgctcgttcctcca 899
|||||| ||||| |||||
Sbjct: 65 gaactgttcgtttctcca 48
>gb|BX254358.1|BX254358 BX254358 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP097E03 similar to Cellulose synthase
catalytic subunit, mRNA sequence
Length = 671
Score = 71.9 bits (36), Expect = 2e-010
Identities = 120/148 (81%)
Strand = Plus / Minus
Query: 499 gagaagatcgaggccagcaggatggaccagacgatgacgatcgtcggcgtcctgttctgc 558
||||| || ||||||||||| || ||||| | || || || || ||||| |||||||||
Sbjct: 362 gagaaaatggaggccagcagaatagaccacaatatcactatagtgggcgttctgttctgc 303
Query: 559 ctccccaccagacccttgaggaacgggtacaggtggacgatcacccagaaggcgaagaag 618
|| |||| |||||||||||||| || ||||| || | ||||||||| ||||||||||
Sbjct: 302 cttcccagaagacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaat 243
Query: 619 agcttcccgaacagggggccccacgact 646
||||| || || ||||| ||||| ||||
Sbjct: 242 agctttccaaagaggggtccccatgact 215
>gb|BE187012.1|BE187012 NXNV_157_H10_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA clone
NXNV_157_H10 5' similar to Arabidopsis thaliana sequence
At4g18780 cellulose synthase catalytic subunit (IRX1) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 477
Score = 71.9 bits (36), Expect = 2e-010
Identities = 172/218 (78%)
Strand = Plus / Minus
Query: 1192 gcccagcgaaggacctggtgaagacggtcggaaaggttcagaggcgcagaacctttgaat 1251
||||| ||||| || ||||| ||||| || || || || | ||| ||||| || ||||||
Sbjct: 340 gcccaacgaagaacttggtgcagacgatctgatagattgataggagcagaccccttgaat 281
Query: 1252 gcaggccgcttcgggatgcagtaaatagaccgccagccatggcagtgcatcttaaatcca 1311
|| || ||| || ||||||||||| || ||||| || ||||||||||||| || ||
Sbjct: 280 gctggtnncttgggcatgcagtaaatggagcgccaccctcggcagtgcatcttgaaacct 221
Query: 1312 gtcaagatatcctctgtgatcgatccataaatccagccaatctcttttccccagtcggtc 1371
|| | || || ||||| | || ||||| ||||| || | |||||| ||||| |||||
Sbjct: 220 gttagaatgtcttctgtcacagaaccatagatccatccgacctctttcccccattcggtt 161
Query: 1372 ttgtcttcgtagccgcagctgataacatgtatagcttc 1409
|| ||||||||||| |||||||| ||||||||||||||
Sbjct: 160 ttctcttcgtagccacagctgatcacatgtatagcttc 123
>gb|BE657157.1|BE657157 NXCI_064_G04_F NXCI (Nsf Xylem Compression wood Inclined) Pinus taeda
cDNA clone NXCI_064_G04 5' similar to Arabidopsis
thaliana sequence At4g18780 cellulose synthase catalytic
subunit (IRX1) see
http://mips.gsf.de/proj/thal/db/index.html, mRNA sequence
Length = 463
Score = 69.9 bits (35), Expect = 8e-010
Identities = 201/257 (78%)
Strand = Plus / Minus
Query: 1153 gggcagtgcttgctgaagaaaatttcgacagacccaagggcccagcgaaggacctggtga 1212
||||||||| ||||||| || ||||| | ||| || | ||||| ||||| || |||||
Sbjct: 421 gggcagtgcctgctgaataagatttcaatagaacccaatgcccaacgaagaacttggtgc 362
Query: 1213 agacggtcggaaaggttcagaggcgcagaacctttgaatgcaggccgcttcgggatgcag 1272
||||| || || || || | ||| ||||| || |||||||| || | ||| || ||||||
Sbjct: 361 agacgatctgatagattgataggagcagaccccttgaatgctggtctcttgggcatgcag 302
Query: 1273 taaatagaccgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatc 1332
||||| || ||||| || | |||||||||| || || || | || || ||||| |
Sbjct: 301 taaatggagcgccaccctcgnnagtgcatcttgaaacctgttagaatgtcttctgtcaca 242
Query: 1333 gatccataaatccagccaatctcttttccccagtcggtcttgtcttcgtagccgcagctg 1392
|| ||||| ||||| || | |||||| ||||| ||||| || ||||||||||| ||||||
Sbjct: 241 gaaccatagatccatccgacctctttcccccattcggttttctcttcgtagccacagctg 182
Query: 1393 ataacatgtatagcttc 1409
|| ||||||||||||||
Sbjct: 181 atcacatgtatagcttc 165
>gb|BF517368.1|BF517368 NXSI_013_F11_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_013_F11 5' similar to Arabidopsis thaliana
sequence At5g17420 cellulose synthase catalytic subunit
(IRX3) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 332
Score = 69.9 bits (35), Expect = 8e-010
Identities = 206/263 (78%)
Strand = Plus / Minus
Query: 1816 ccatccaaacctttcatgttgatatcaaaaaagacaacgttcctgttagcatatcgatca 1875
|||||||| || |||||||||||||| || || ||| ||| | || |||||||||||
Sbjct: 268 ccatccaatcccttcatgttgatatcgaagaacacagtgtttcgattggcatatcgatcg 209
Query: 1876 tgacggtcaataccaccaaacctctgagggaactgtacatagcacactttcttccccacc 1935
|| || |||||| | |||||||| |||||||| || |||||||| ||| | || |||
Sbjct: 208 ctgcgatcgataccatcgaacctctgtgggaactgcacgtagcacacgttccttccaacc 149
Query: 1936 aaaggatccatcatgaaacacatagcctcttttatggccttgctattgttgatgtagtga 1995
|||||||||||| || ||||| || || | ||||||||| || || | |||||||
Sbjct: 148 tcaggatccatcataaagcacattgcttcgcgaacggccttgctgttattaacgtagtga 89
Query: 1996 tcacagtccaagttcaataggtatgcagcatttgataagacagcagagacacggaccagt 2055
||||| |||||||||| ||||||| || || | | || |||||||| || |||| |
Sbjct: 88 tcacaatccaagttcagcaggtatggggcgttcgtcagtacggcagagactcgaaccaat 29
Query: 2056 gcattcatggcaccagccttctt 2078
|||||||||||||| ||||||||
Sbjct: 28 gcattcatggcaccggccttctt 6
>gb|AA556746.1|AA556746 588 Loblolly pine NA Pinus taeda cDNA clone 1NAB10D, mRNA sequence
Length = 546
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 1336 ccataaatccagccaatctcttttccccagtcggtcttgtcttcgtagccgcagctgata 1395
||||| ||||| || | |||||| ||||| ||||| || ||||||||||| ||||||||
Sbjct: 374 ccatagatccatccgacctctttcccccattcggttttctcttcgtagccacagctgatc 315
Query: 1396 acatgtatagcttc 1409
||||||||||||||
Sbjct: 314 acatgtatagcttc 301
>gb|BG275945.1|BG275945 NXSI_149_G12_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_149_G12 5' similar to Arabidopsis thaliana
sequence At4g18780 cellulose synthase catalytic subunit
(IRX1) see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 530
Score = 65.9 bits (33), Expect = 1e-008
Identities = 114/141 (80%)
Strand = Plus / Minus
Query: 1782 acatccagtacccacataaatgggcccttgaataccatccaaacctttcatgttgatatc 1841
|||||||||||||||||| | |||||||| || |||||||| || ||||||||||||||
Sbjct: 145 acatccagtacccacatacactggcccttggatgccatccaatcccttcatgttgatatc 86
Query: 1842 aaaaaagacaacgttcctgttagcatatcgatcatgacggtcaataccaccaaacctctg 1901
|| || ||| ||| | || ||||||||||| || || |||||| | ||||||||
Sbjct: 85 gaagaacacagtgtttcgattggcatatcgatcgctgcgatcgataccatcgaacctctg 26
Query: 1902 agggaactgtacatagcacac 1922
|||||||| || ||||||||
Sbjct: 25 tgggaactgcacgtagcacac 5
>gb|BX682482.1|BX682482 BX682482 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone 117C02 similar to Cellulose synthase
catalytic subunit (EC 2.4.1.12), mRNA sequence
Length = 500
Score = 65.9 bits (33), Expect = 1e-008
Identities = 102/125 (81%)
Strand = Plus / Minus
Query: 499 gagaagatcgaggccagcaggatggaccagacgatgacgatcgtcggcgtcctgttctgc 558
||||| || ||||||||||| || ||||| | || || || || ||||| |||||||||
Sbjct: 140 gagaaaatggaggccagcagaatagaccacaatatcactatagtgggcgttctgttctgc 81
Query: 559 ctccccaccagacccttgaggaacgggtacaggtggacgatcacccagaaggcgaagaag 618
|| |||| |||||||||||||| || ||||| || | ||||||||| ||||||||||
Sbjct: 80 cttcccagaagacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaat 21
Query: 619 agctt 623
|||||
Sbjct: 20 agctt 16
>gb|BX682490.1|BX682490 BX682490 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone 117D02 similar to Cellulose synthase
catalytic subunit (EC 2.4.1.12), mRNA sequence
Length = 478
Score = 65.9 bits (33), Expect = 1e-008
Identities = 102/125 (81%)
Strand = Plus / Minus
Query: 499 gagaagatcgaggccagcaggatggaccagacgatgacgatcgtcggcgtcctgttctgc 558
||||| || ||||||||||| || ||||| | || || || || ||||| |||||||||
Sbjct: 140 gagaaaatggaggccagcagaatagaccacaatatcactatagtgggcgttctgttctgc 81
Query: 559 ctccccaccagacccttgaggaacgggtacaggtggacgatcacccagaaggcgaagaag 618
|| |||| |||||||||||||| || ||||| || | ||||||||| ||||||||||
Sbjct: 80 cttcccagaagacccttgaggaagggatacagatgcaatatcacccagcaggcgaagaat 21
Query: 619 agctt 623
|||||
Sbjct: 20 agctt 16
>gb|CX646526.1|CX646526 COLD1_9_H07.g1_A029 Root cold Pinus taeda cDNA clone COLD1_9_H07_A029
5', mRNA sequence
Length = 853
Score = 65.9 bits (33), Expect = 1e-008
Identities = 201/257 (78%)
Strand = Plus / Minus
Query: 1153 gggcagtgcttgctgaagaaaatttcgacagacccaagggcccagcgaaggacctggtga 1212
||||||||| ||||||| || ||||| | ||| || | ||||| ||||| || |||||
Sbjct: 279 gggcagtgcctgctgaataagatttcaatagaacccaatgcccaacgaagaacttggtgc 220
Query: 1213 agacggtcggaaaggttcagaggcgcagaacctttgaatgcaggccgcttcgggatgcag 1272
||||| || || || || | ||| ||||| || |||||||| || | ||| || ||||||
Sbjct: 219 agacgatctgatagattgataggagcagaccccttgaatgctggtctcttgggcatgcag 160
Query: 1273 taaatagaccgccagccatggcagtgcatcttaaatccagtcaagatatcctctgtgatc 1332
||||| || ||||| || ||||||||||||| || || || | || || ||||| |
Sbjct: 159 taaatggagcgccatcctcggcagtgcatcttgaaacctgttagaatgtcttctgtcaca 100
Query: 1333 gatccataaatccagccaatctcttttccccagtcggtcttgtcttcgtagccgcagctg 1392
|| ||||| ||||| || | |||||| ||||| ||||| || ||||||||||| || ||
Sbjct: 99 gaaccatagatccatccgacctctttcccccattcggttttctcttcgtagccacaaatg 40
Query: 1393 ataacatgtatagcttc 1409
|| ||||||||||||||
Sbjct: 39 atcacatgtatagcttc 23
Score = 56.0 bits (28), Expect = 1e-005
Identities = 70/84 (83%)
Strand = Plus / Minus
Query: 868 cctccgatgacccagaactgctcgttcctccaccagtcgtcgatggccacgccactccac 927
||||| || ||||| ||||| |||||||||||||| || |||||| ||| ||||||||
Sbjct: 567 cctccaatcacccaaaactgttcgttcctccaccattcttcgatgctcactccactccat 508
Query: 928 ctcatttccaggatgccggtcacg 951
|||| |||||| | ||| ||||||
Sbjct: 507 ctcagttccagaacgcccgtcacg 484
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 430,824
Number of Sequences: 355925
Number of extensions: 430824
Number of successful extensions: 124657
Number of sequences better than 0.5: 412
Number of HSP's better than 0.5 without gapping: 379
Number of HSP's successfully gapped in prelim test: 33
Number of HSP's that attempted gapping in prelim test: 123832
Number of HSP's gapped (non-prelim): 765
length of query: 3914
length of database: 217,277,237
effective HSP length: 20
effective length of query: 3894
effective length of database: 210,158,737
effective search space: 818358121878
effective search space used: 818358121878
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)