BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2276562.2.1
(1286 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
dbj|BD236034.1| Materials and method for modification of pl... 54 1e-005
dbj|BD236037.1| Materials and method for modification of pl... 54 1e-005
>dbj|BD236034.1| Materials and method for modification of plant cell wall
polysaccharides
Length = 1293
Score = 54.0 bits (27), Expect = 1e-005
Identities = 60/71 (84%)
Strand = Plus / Minus
Query: 1043 atggagatgatcagcttctcgttggtgccccaaccttcgaaggccttgtggagctgctcg 1102
||||| |||||||||||||| || || ||||| ||| ||||||| | |||||||||||
Sbjct: 204 atggatatgatcagcttctcatttgttccccatcctgcgaaggctgtccggagctgctcg 145
Query: 1103 cagtcctcggc 1113
||||| |||||
Sbjct: 144 cagtcatcggc 134
>dbj|BD236037.1| Materials and method for modification of plant cell wall
polysaccharides
Length = 789
Score = 54.0 bits (27), Expect = 1e-005
Identities = 132/167 (79%)
Strand = Plus / Minus
Query: 467 agaaactcatccttggggtcagctttcagatccttgttgattgcatgagtgaactgatcc 526
||||| ||||| || || ||||| ||||||||||||||||| |||| |||| ||
Sbjct: 758 agaaattcatcatttggatcagccttcagatccttgttgatggcattcccaaactcattg 699
Query: 527 ttgtagctattgaatgttgcaagtagctgagctttgctccgtgtggtgagaattctaatg 586
|||||| ||||| |||||| ||||||||||| || | ||| || | |||||| |||
Sbjct: 698 ttgtagtaattgagggttgcattaagctgagctttacttcttgtagtaacaattctgatg 639
Query: 587 atctcctcatcactgtaagccttcttatggatcttctcatgaagtat 633
| ||| |||| | |||||||||||| || |||||||||||||||||
Sbjct: 638 agctcatcatgattgtaagccttctcgtgaatcttctcatgaagtat 592
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 122,431
Number of Sequences: 355925
Number of extensions: 122431
Number of successful extensions: 31640
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31634
Number of HSP's gapped (non-prelim): 6
length of query: 1286
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1267
effective length of database: 210,514,662
effective search space: 266722076754
effective search space used: 266722076754
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)