BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2192593.2.1
         (800 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|DR681812.1|DR681812  EST1071887 Normalized pine embryo li...    54   9e-006
gb|CF479741.1|CF479741  RTWW3_12_B06.b1_A022 Well-watered lo...    50   1e-004

>gb|DR681812.1|DR681812 EST1071887 Normalized pine embryo library, Lib_D Pinus taeda cDNA
           clone PWAA204, mRNA sequence
          Length = 575

 Score = 54.0 bits (27), Expect = 9e-006
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 276 atgacgatcgcacaggatgaaatctttgggccggtgatggctctcatgaaattcaagac 334
           |||| ||| |||||||||||||||||||| || |||||| || |  |||||||||||||
Sbjct: 463 atgaagattgcacaggatgaaatctttggaccagtgatgtctattttgaaattcaagac 405



>gb|CF479741.1|CF479741 RTWW3_12_B06.b1_A022 Well-watered loblolly pine roots WW3 Pinus
           taeda cDNA clone RTWW3_12_B06_A022 3', mRNA sequence
          Length = 599

 Score = 50.1 bits (25), Expect = 1e-004
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 229 agggctactacatcgagcccaccatcttc 257
           ||||||||| |||||||||||||||||||
Sbjct: 74  agggctacttcatcgagcccaccatcttc 102



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 68,476
Number of Sequences: 355925
Number of extensions: 68476
Number of successful extensions: 18764
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18760
Number of HSP's gapped (non-prelim): 4
length of query: 800
length of database: 217,277,237
effective HSP length: 19
effective length of query: 781
effective length of database: 210,514,662
effective search space: 164411951022
effective search space used: 164411951022
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)