BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2161254.2.1
(1192 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|DR167393.1|DR167393 RTPHOS1_18_B12.g1_A029 Roots minus p... 94 2e-017
gb|DR687165.1|DR687165 EST1077243 Normalized pine embryo li... 74 1e-011
gb|DT634133.1|DT634133 EST1149064 Normalized pine embryo li... 74 1e-011
gb|AW011359.1|AW011359 ST19H02 Pine TriplEx shoot tip libra... 68 9e-010
gb|CO366432.1|CO366432 RTK1_27_G06.g1_A029 Roots minus pota... 46 0.003
>gb|DR167393.1|DR167393 RTPHOS1_18_B12.g1_A029 Roots minus phosphorous Pinus taeda cDNA clone
RTPHOS1_18_B12_A029 5', mRNA sequence
Length = 785
Score = 93.7 bits (47), Expect = 2e-017
Identities = 206/259 (79%)
Strand = Plus / Plus
Query: 934 gtttggcttgatcaagtatcactcatgcctgaagacacatacaagggacatggtttccgc 993
|||||| |||||||||| || |||||||| ||| |||| ||||||||||||||| ||
Sbjct: 361 gtttggtttgatcaagtttctgccatgcctgtagatacattcaagggacatggttttcga 420
Query: 994 acagaacttatatccatgcttttggatttgaaaccacgattcttgagatttcctggaggt 1053
| || ||| |||||||||| ||| |||||||| || | ||||| || || ||
Sbjct: 421 aaaggactagcatccatgcttgctgatctgaaaccagcttttatcagattcccaggtggc 480
Query: 1054 tgttttgtagaaggtgactggctaagaaatgcattcagatggagagaatcaattggtcca 1113
|||||||||||||| | ||||| ||||||||||| ||||| |||||||||| |||
Sbjct: 481 tgttttgtagaaggggtatggcttagaaatgcatttccctggaggcaatcaattggacca 540
Query: 1114 tgggaagagaggcctggacacttcggggatgtttggcattactggactgatgatgggctt 1173
||||| ||||||||||| || || || ||||| ||| || ||||||||||||||||||
Sbjct: 541 tgggaggagaggcctggtcattttggtgatgtatggggctattggactgatgatgggctt 600
Query: 1174 ggatattatgagttccttc 1192
|| | ||||||||| ||||
Sbjct: 601 gggttttatgagtttcttc 619
>gb|DR687165.1|DR687165 EST1077243 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWABO01 3' end, mRNA sequence
Length = 784
Score = 73.8 bits (37), Expect = 1e-011
Identities = 79/93 (84%)
Strand = Plus / Plus
Query: 1100 aatcaattggtccatgggaagagaggcctggacacttcggggatgtttggcattactgga 1159
|||||||||| |||||||| ||||||||||| || || || ||||| ||| || ||||
Sbjct: 22 aatcaattggaccatgggaggagaggcctggtcattttggtgatgtatggggctattgga 81
Query: 1160 ctgatgatgggcttggatattatgagttccttc 1192
|||||||||||||||| | ||||||||| ||||
Sbjct: 82 ctgatgatgggcttgggttttatgagtttcttc 114
>gb|DT634133.1|DT634133 EST1149064 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMG262 3' end, mRNA sequence
Length = 803
Score = 73.8 bits (37), Expect = 1e-011
Identities = 79/93 (84%)
Strand = Plus / Plus
Query: 1100 aatcaattggtccatgggaagagaggcctggacacttcggggatgtttggcattactgga 1159
|||||||||| |||||||| ||||||||||| || || || ||||| ||| || ||||
Sbjct: 30 aatcaattggaccatgggaggagaggcctggtcattttggtgatgtatggggctattgga 89
Query: 1160 ctgatgatgggcttggatattatgagttccttc 1192
|||||||||||||||| | ||||||||| ||||
Sbjct: 90 ctgatgatgggcttgggttttatgagtttcttc 122
>gb|AW011359.1|AW011359 ST19H02 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST19H02, mRNA sequence
Length = 601
Score = 67.9 bits (34), Expect = 9e-010
Identities = 100/122 (81%)
Strand = Plus / Plus
Query: 1054 tgttttgtagaaggtgactggctaagaaatgcattcagatggagagaatcaattggtcca 1113
|||||||||||||| | |||| ||||||||||| ||||| |||||||||| |||
Sbjct: 282 tgttttgtagaaggggtatggcatagaaatgcatttccctggaggcaatcaattggacca 341
Query: 1114 tgggaagagaggcctggacacttcggggatgtttggcattactggactgatgatgggctt 1173
||||| ||||||||||| || || || ||||| ||| || ||||||||||||||||||
Sbjct: 342 tgggaggagaggcctggtcattttggtgatgtatggggctattggactgatgatgggctt 401
Query: 1174 gg 1175
||
Sbjct: 402 gg 403
Score = 42.1 bits (21), Expect = 0.052
Identities = 47/56 (83%)
Strand = Plus / Plus
Query: 934 gtttggcttgatcaagtatcactcatgcctgaagacacatacaagggacatggttt 989
|||||| |||||||||| || |||||||| | | |||| |||||||||||||||
Sbjct: 161 gtttggtttgatcaagtttctgccatgcctgtanatacattcaagggacatggttt 216
>gb|CO366432.1|CO366432 RTK1_27_G06.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_27_G06_A029 5', mRNA sequence
Length = 812
Score = 46.1 bits (23), Expect = 0.003
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 436 ctgtttgggatattttttgaggagatcaaccatgcaggagctggtgg 482
|||||||| ||||||| |||||||| || ||||| |||||||||||
Sbjct: 755 ctgtttggactatttttcgaggagataaatcatgctggagctggtgg 801
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 147,829
Number of Sequences: 355925
Number of extensions: 147829
Number of successful extensions: 39394
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39383
Number of HSP's gapped (non-prelim): 9
length of query: 1192
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1173
effective length of database: 210,514,662
effective search space: 246933698526
effective search space used: 246933698526
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)