BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2161200.2.1
         (845 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CF664280.1|CF664280  RTCNT1_8_F09.g1_A029 Root control Pi...    42   0.036
gb|DR742708.1|DR742708  RTCU1_6_B04.g2_A029 Roots plus added...    42   0.036

>gb|CF664280.1|CF664280 RTCNT1_8_F09.g1_A029 Root control Pinus taeda cDNA clone
           RTCNT1_8_F09_A029 5', mRNA sequence
          Length = 434

 Score = 42.1 bits (21), Expect = 0.036
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 378 ggcggcggcggcggtgtcgga 398
           |||||||||||||||||||||
Sbjct: 237 ggcggcggcggcggtgtcgga 217



>gb|DR742708.1|DR742708 RTCU1_6_B04.g2_A029 Roots plus added copper Pinus taeda cDNA clone
           RTCU1_6_B04_A029 5', mRNA sequence
          Length = 697

 Score = 42.1 bits (21), Expect = 0.036
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 378 ggcggcggcggcggtgtcgga 398
           |||||||||||||||||||||
Sbjct: 364 ggcggcggcggcggtgtcgga 344



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 91,582
Number of Sequences: 355925
Number of extensions: 91582
Number of successful extensions: 27143
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 27115
Number of HSP's gapped (non-prelim): 28
length of query: 845
length of database: 217,277,237
effective HSP length: 19
effective length of query: 826
effective length of database: 210,514,662
effective search space: 173885110812
effective search space used: 173885110812
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)