BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1805139.2.1
(950 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW869996.1|AW869996 NXNV_120_G12_F Nsf Xylem Normal wood... 72 5e-011
gb|BE520108.1|BE520108 NXCI_016_H09_F NXCI (Nsf Xylem Compr... 72 5e-011
gb|BF220863.1|BF220863 NXCI_155_A01_F NXCI (Nsf Xylem Compr... 72 5e-011
gb|BF518064.1|BF518064 NXSI_030_E11_F NXSI (Nsf Xylem Side ... 72 5e-011
gb|BF518065.1|BF518065 NXSI_030_E12_F NXSI (Nsf Xylem Side ... 72 5e-011
gb|CF477204.1|CF477204 RTWW3_6_C08.g1_A022 Well-watered lob... 72 5e-011
gb|CF672139.1|CF672139 RTCNT1_61_D05.g1_A029 Root control P... 72 5e-011
gb|CO368683.1|CO368683 RTK1_42_D09.b1_A029 Roots minus pota... 72 5e-011
gb|CO368907.1|CO368907 RTK1_43_D10.g1_A029 Roots minus pota... 72 5e-011
gb|CV035130.1|CV035130 RTNACL1_13_F12.g1_A029 Roots plus ad... 72 5e-011
gb|DR011028.1|DR011028 HEAT1_2_H06.g1_A029 Root at 37 C for... 72 5e-011
gb|DR743246.1|DR743246 RTCU1_14_C05.g1_A029 Roots plus adde... 72 5e-011
gb|AA556813.1|AA556813 655 Loblolly pine C Pinus taeda cDNA... 66 3e-009
gb|AW226006.1|AW226006 ST76C03 Pine TriplEx shoot tip libra... 64 1e-008
gb|CO163161.1|CO163161 FLD1_39_G12.g1_A029 Root flooded Pin... 64 1e-008
gb|CO199718.1|CO199718 GEO2_3_C05.b1_A032 Root gravitropism... 64 1e-008
gb|DR059266.1|DR059266 RTNIT1_16_E05.g1_A029 Roots minus ni... 62 4e-008
gb|DR058934.1|DR058934 RTNIT1_14_F04.g1_A029 Roots minus ni... 58 7e-007
gb|BM903420.1|BM903420 NXRV_041_C08_F NXRV (Nsf Xylem Root ... 56 3e-006
gb|BQ700475.1|BQ700475 NXRV107_B08_F NXRV (Nsf Xylem Root w... 56 3e-006
gb|CF399609.1|CF399609 RTDS3_26_E02.g1_A022 Drought-stresse... 56 3e-006
gb|CO368835.1|CO368835 RTK1_43_D10.b1_A029 Roots minus pota... 48 7e-004
gb|BX250799.1|BX250799 BX250799 Pinus pinaster differenciat... 46 0.003
gb|BE644138.1|BE644138 NXCI_054_H09_F NXCI (Nsf Xylem Compr... 46 0.003
gb|BQ701711.1|BQ701711 NXSI_118_G02_F NXSI (Nsf Xylem Side ... 46 0.003
gb|CF389446.1|CF389446 RTDR2_7_D03.g1_A021 Loblolly pine ro... 46 0.003
gb|CF390163.1|CF390163 RTDR2_12_E06.g1_A021 Loblolly pine r... 46 0.003
gb|BX682196.1|BX682196 BX682196 RS Pinus pinaster cDNA clon... 46 0.003
gb|CO159320.1|CO159320 FLD1_12_H01.g1_A029 Root flooded Pin... 46 0.003
gb|CX652552.1|CX652552 COLD1_59_G09.g1_A029 Root cold Pinus... 46 0.003
gb|CX653219.1|CX653219 COLD1_64_D11.b1_A029 Root cold Pinus... 46 0.003
gb|CX653292.1|CX653292 COLD1_64_D11.g1_A029 Root cold Pinus... 46 0.003
gb|DR012004.1|DR012004 HEAT1_9_A04.g1_A029 Root at 37 C for... 46 0.003
gb|DR015870.1|DR015870 STRS1_6_E08.b1_A034 Shoot tip pitch ... 46 0.003
gb|DR015949.1|DR015949 STRS1_6_E08.g1_A034 Shoot tip pitch ... 46 0.003
gb|DR047460.1|DR047460 RTBOR1_1_E07.b1_A029 Roots plus adde... 46 0.003
gb|DR078300.1|DR078300 RTFEPL1_3_E07.b1_A029 Roots plus add... 46 0.003
gb|DR078368.1|DR078368 RTFEPL1_3_E07.g1_A029 Roots plus add... 46 0.003
gb|DR078441.1|DR078441 RTFEPL1_4_E07.b1_A029 Roots plus add... 46 0.003
gb|DR081137.1|DR081137 RTFEPL1_27_E02.g1_A029 Roots plus ad... 46 0.003
gb|DR109623.1|DR109623 RTS1_3_C05.g1_A029 Roots minus sulfu... 46 0.003
gb|DR116719.1|DR116719 RTMG1_2_H06.b1_A029 Roots minus magn... 46 0.003
gb|DR116804.1|DR116804 RTMG1_2_H06.g1_A029 Roots minus magn... 46 0.003
gb|DR168155.1|DR168155 RTPHOS1_23_C06.g1_A029 Roots minus p... 46 0.003
gb|DR683816.1|DR683816 EST1073892 Normalized pine embryo li... 46 0.003
gb|DR694258.1|DR694258 EST1084349 Normalized pine embryo li... 46 0.003
gb|DR695125.1|DR695125 EST1085218 Normalized pine embryo li... 46 0.003
gb|DR744517.1|DR744517 RTCU1_23_B05.b1_A029 Roots plus adde... 46 0.003
gb|DT631539.1|DT631539 EST1146470 Normalized pine embryo li... 46 0.003
gb|DT638590.1|DT638590 EST1153521 Normalized pine embryo li... 46 0.003
gb|BF516910.1|BF516910 NXSI_005_F04_F NXSI (Nsf Xylem Side ... 42 0.041
gb|CF664880.1|CF664880 RTCNT1_12_B07.g1_A029 Root control P... 42 0.041
gb|CF672019.1|CF672019 RTCNT1_60_F11.g1_A029 Root control P... 42 0.041
gb|CO160922.1|CO160922 FLD1_25_B04.g1_A029 Root flooded Pin... 42 0.041
gb|CO367617.1|CO367617 RTK1_35_A06.g1_A029 Roots minus pota... 42 0.041
gb|CV034443.1|CV034443 RTNACL1_9_A04.b1_A029 Roots plus add... 42 0.041
gb|CX648436.1|CX648436 COLD1_28_D09.g1_A029 Root cold Pinus... 42 0.041
gb|DR020571.1|DR020571 STRS1_37_H07.g1_A034 Shoot tip pitch... 42 0.041
gb|DR068453.1|DR068453 RTDK1_1_A03.b1_A029 Roots, dark Pinu... 42 0.041
gb|DR109640.1|DR109640 RTS1_3_E07.g1_A029 Roots minus sulfu... 42 0.041
gb|DR118198.1|DR118198 RTMG1_11_F01.g1_A029 Roots minus mag... 42 0.041
gb|DR119006.1|DR119006 RTMG1_20_C03.g1_A029 Roots minus mag... 42 0.041
gb|DR159917.1|DR159917 RTFE1_2_B04.g1_A029 Roots minus iron... 42 0.041
gb|DR385412.1|DR385412 RTHG1_8_B08.g1_A029 Roots plus added... 42 0.041
gb|DR694175.1|DR694175 EST1084265 Normalized pine embryo li... 42 0.041
gb|DT638620.1|DT638620 EST1153551 Normalized pine embryo li... 42 0.041
>gb|AW869996.1|AW869996 NXNV_120_G12_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_120_G12 5' similar to Arabidopsis thaliana
sequence At1g10200 putative transcription factor see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 530
Score = 71.9 bits (36), Expect = 5e-011
Identities = 123/152 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 229 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 170
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 169 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 110
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 109 ttgcaatgatggcagcggaagcaggccttgtg 78
>gb|BE520108.1|BE520108 NXCI_016_H09_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_016_H09 5' similar to Arabidopsis
thaliana sequence At1g10200 putative transcription
factor see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 533
Score = 71.9 bits (36), Expect = 5e-011
Identities = 123/152 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 284 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 225
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 224 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 165
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 164 ttgcaatgatggcagcggaagcaggccttgtg 133
>gb|BF220863.1|BF220863 NXCI_155_A01_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_155_A01 5' similar to Arabidopsis
thaliana sequence At1g10200 putative transcription
factor see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 538
Score = 71.9 bits (36), Expect = 5e-011
Identities = 123/152 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 303 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 244
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 243 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 184
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 183 ttgcaatgatggcagcggaagcaggccttgtg 152
>gb|BF518064.1|BF518064 NXSI_030_E11_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_030_E11 5' similar to Arabidopsis thaliana
sequence At1g10200 putative transcription factor see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 522
Score = 71.9 bits (36), Expect = 5e-011
Identities = 123/152 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 221 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 162
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 161 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 102
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 101 ttgcaatgatggcagcggaagcaggccttgtg 70
>gb|BF518065.1|BF518065 NXSI_030_E12_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_030_E12 5' similar to Arabidopsis thaliana
sequence At1g10200 putative transcription factor see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 531
Score = 71.9 bits (36), Expect = 5e-011
Identities = 123/152 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 221 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 162
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 161 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 102
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 101 ttgcaatgatggcagcggaagcaggccttgtg 70
>gb|CF477204.1|CF477204 RTWW3_6_C08.g1_A022 Well-watered loblolly pine roots WW3 Pinus
taeda cDNA clone RTWW3_6_C08_A022 5', mRNA sequence
Length = 746
Score = 71.9 bits (36), Expect = 5e-011
Identities = 123/152 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 299 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 240
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 239 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 180
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 179 ttgcaatgatggcagcggaagcaggccttgtg 148
>gb|CF672139.1|CF672139 RTCNT1_61_D05.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_61_D05_A029 5', mRNA sequence
Length = 669
Score = 71.9 bits (36), Expect = 5e-011
Identities = 123/152 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 217 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 158
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 157 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 98
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 97 ttgcaatgatggcagcggaagcaggccttgtg 66
>gb|CO368683.1|CO368683 RTK1_42_D09.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_42_D09_A029 3', mRNA sequence
Length = 837
Score = 71.9 bits (36), Expect = 5e-011
Identities = 123/152 (80%)
Strand = Plus / Plus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 532 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 591
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 592 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 651
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 652 ttgcaatgatggcagcggaagcaggccttgtg 683
>gb|CO368907.1|CO368907 RTK1_43_D10.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_43_D10_A029 5', mRNA sequence
Length = 726
Score = 71.9 bits (36), Expect = 5e-011
Identities = 123/152 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 281 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 222
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 221 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 162
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 161 ttgcaatgatggcagcggaagcaggccttgtg 130
>gb|CV035130.1|CV035130 RTNACL1_13_F12.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_13_F12_A029 5', mRNA sequence
Length = 798
Score = 71.9 bits (36), Expect = 5e-011
Identities = 123/152 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 292 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 233
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 232 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 173
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 172 ttgcaatgatggcagcggaagcaggccttgtg 141
>gb|DR011028.1|DR011028 HEAT1_2_H06.g1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_2_H06_A029 5', mRNA sequence
Length = 763
Score = 71.9 bits (36), Expect = 5e-011
Identities = 123/152 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 376 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 317
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 316 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 257
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 256 ttgcaatgatggcagcggaagcaggccttgtg 225
>gb|DR743246.1|DR743246 RTCU1_14_C05.g1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_14_C05_A029 5', mRNA sequence
Length = 693
Score = 71.9 bits (36), Expect = 5e-011
Identities = 123/152 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 269 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 210
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 209 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 150
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 149 ttgcaatgatggcagcggaagcaggccttgtg 118
>gb|AA556813.1|AA556813 655 Loblolly pine C Pinus taeda cDNA clone 6C12H, mRNA sequence
Length = 677
Score = 65.9 bits (33), Expect = 3e-009
Identities = 122/152 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || ||| |||| || ||||| ||||||
Sbjct: 196 ttgggagttccttcaaaacttttgtcaagacttccagtcntcttaaagagctgatcgaag 137
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 136 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 77
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 76 ttgcaatgatggcagcggaagcaggccttgtg 45
>gb|AW226006.1|AW226006 ST76C03 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST76C03, mRNA sequence
Length = 437
Score = 63.9 bits (32), Expect = 1e-008
Identities = 121/152 (79%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || | |||||||| || |||| ||||||
Sbjct: 330 ttgggagttccttcaaaacttttgtcaagactnncagtcctcttaaagagctnntcgaag 271
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 270 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 211
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 210 ttgcaatgatggcagcggaagcaggccttgtg 179
>gb|CO163161.1|CO163161 FLD1_39_G12.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_39_G12_A029 5', mRNA sequence
Length = 829
Score = 63.9 bits (32), Expect = 1e-008
Identities = 122/152 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 273 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 214
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| | ||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 213 tgaggtttacagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 154
Query: 747 ttgcagtggtggcagcggaagcaggccttgtg 778
||||| || |||||||||||||||||||||||
Sbjct: 153 ttgcaatgatggcagcggaagcaggccttgtg 122
>gb|CO199718.1|CO199718 GEO2_3_C05.b1_A032 Root gravitropism October 2003 test Pinus taeda
cDNA clone GEO2_3_C05_A032 3', mRNA sequence
Length = 901
Score = 63.9 bits (32), Expect = 1e-008
Identities = 95/116 (81%)
Strand = Plus / Plus
Query: 663 gtcctcttgaacagctggtcgaagtgaggcctgcagtagagcactccctcgaaggagttg 722
|||||||| || ||||| ||||||||||| ||||||| ||||| || || || ||
Sbjct: 544 gtcctcttaaagagctgatcgaagtgaggtttgcagtacagcaccccttcaaaagaagaa 603
Query: 723 tagttggcgagcttgagggtgcccttgcagtggtggcagcggaagcaggccttgtg 778
|||||| |||||| | |||||| ||||| || |||||||||||||||||||||||
Sbjct: 604 tagttgctgagctttaaggtgccattgcaatgatggcagcggaagcaggccttgtg 659
>gb|DR059266.1|DR059266 RTNIT1_16_E05.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_16_E05_A029 5', mRNA sequence
Length = 585
Score = 61.9 bits (31), Expect = 4e-008
Identities = 118/147 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 147 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 88
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 87 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 28
Query: 747 ttgcagtggtggcagcggaagcaggcc 773
||||| || ||||||||||||||||||
Sbjct: 27 ttgcaatgatggcagcggaagcaggcc 1
>gb|DR058934.1|DR058934 RTNIT1_14_F04.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_14_F04_A029 5', mRNA sequence
Length = 659
Score = 58.0 bits (29), Expect = 7e-007
Identities = 116/145 (80%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 145 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 86
Query: 687 tgaggcctgcagtagagcactccctcgaaggagttgtagttggcgagcttgagggtgccc 746
||||| ||||||| ||||| || || || || |||||| |||||| | ||||||
Sbjct: 85 tgaggtttgcagtacagcaccccttcaaaagaagaatagttgctgagctttaaggtgcca 26
Query: 747 ttgcagtggtggcagcggaagcagg 771
||||| || ||||||||||||||||
Sbjct: 25 ttgcaatgatggcagcggaagcagg 1
>gb|BM903420.1|BM903420 NXRV_041_C08_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV_041_C08 5' similar to Arabidopsis thaliana
sequence At1g10200 putative transcription factor see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 416
Score = 56.0 bits (28), Expect = 3e-006
Identities = 43/48 (89%)
Strand = Plus / Minus
Query: 731 gagcttgagggtgcccttgcagtggtggcagcggaagcaggccttgtg 778
|||||| | |||||| ||||| || |||||||||||||||||||||||
Sbjct: 110 gagctttaaggtgccattgcaatgatggcagcggaagcaggccttgtg 63
>gb|BQ700475.1|BQ700475 NXRV107_B08_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV107_B08 5' similar to Arabidopsis thaliana
sequence At1g10200 putative transcription factor see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 336
Score = 56.0 bits (28), Expect = 3e-006
Identities = 43/48 (89%)
Strand = Plus / Minus
Query: 731 gagcttgagggtgcccttgcagtggtggcagcggaagcaggccttgtg 778
|||||| | |||||| ||||| || |||||||||||||||||||||||
Sbjct: 167 gagctttaaggtgccattgcaatgatggcagcggaagcaggccttgtg 120
>gb|CF399609.1|CF399609 RTDS3_26_E02.g1_A022 Drought-stressed loblolly pine roots DS3 Pinus
taeda cDNA clone RTDS3_26_E02_A022 5', mRNA sequence
Length = 349
Score = 56.0 bits (28), Expect = 3e-006
Identities = 43/48 (89%)
Strand = Plus / Minus
Query: 731 gagcttgagggtgcccttgcagtggtggcagcggaagcaggccttgtg 778
|||||| | |||||| ||||| || |||||||||||||||||||||||
Sbjct: 93 gagctttaaggtgccattgcaatgatggcagcggaagcaggccttgtg 46
>gb|CO368835.1|CO368835 RTK1_43_D10.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_43_D10_A029 3', mRNA sequence
Length = 831
Score = 48.1 bits (24), Expect = 7e-004
Identities = 66/80 (82%)
Strand = Plus / Minus
Query: 627 ttgggagttccttcgaagctcttgtccaagctccctgtcctcttgaacagctggtcgaag 686
|||||||||||||| || || ||||| | || || |||||||| || ||||| ||||||
Sbjct: 88 ttgggagttccttcaaaacttttgtcaagacttccagtcctcttaaagagctgatcgaag 29
Query: 687 tgaggcctgcagtagagcac 706
||||| ||||||| |||||
Sbjct: 28 tgaggtttgcagtacagcac 9
>gb|BX250799.1|BX250799 BX250799 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP041D09, mRNA sequence
Length = 676
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 568 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 526
>gb|BE644138.1|BE644138 NXCI_054_H09_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_054_H09 5' similar to Arabidopsis
thaliana sequence At3g55770 transcription factor L2 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 407
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 222 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 180
>gb|BQ701711.1|BQ701711 NXSI_118_G02_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_118_G02 5' similar to Arabidopsis thaliana
sequence At3g55770 transcription factor L2 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 548
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 522 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 480
>gb|CF389446.1|CF389446 RTDR2_7_D03.g1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_7_D03_A021 5', mRNA
sequence
Length = 674
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 553 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 511
>gb|CF390163.1|CF390163 RTDR2_12_E06.g1_A021 Loblolly pine roots recovering from drought
DR2 Pinus taeda cDNA clone RTDR2_12_E06_A021 5', mRNA
sequence
Length = 671
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 467 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 425
>gb|BX682196.1|BX682196 BX682196 RS Pinus pinaster cDNA clone RS73E02, mRNA sequence
Length = 210
Score = 46.1 bits (23), Expect = 0.003
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 756 tggcagcggaagcaggccttgtg 778
|||||||||||||||||||||||
Sbjct: 151 tggcagcggaagcaggccttgtg 129
>gb|CO159320.1|CO159320 FLD1_12_H01.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_12_H01_A029 5', mRNA sequence
Length = 380
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 286 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 244
>gb|CX652552.1|CX652552 COLD1_59_G09.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_59_G09_A029 5', mRNA sequence
Length = 542
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 231 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 189
>gb|CX653219.1|CX653219 COLD1_64_D11.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_64_D11_A029 3', mRNA sequence
Length = 770
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 54 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 12
>gb|CX653292.1|CX653292 COLD1_64_D11.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_64_D11_A029 5', mRNA sequence
Length = 767
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 605 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 563
>gb|DR012004.1|DR012004 HEAT1_9_A04.g1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_9_A04_A029 5', mRNA sequence
Length = 663
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 333 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 291
>gb|DR015870.1|DR015870 STRS1_6_E08.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_6_E08_A034 3', mRNA sequence
Length = 880
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 209 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 251
>gb|DR015949.1|DR015949 STRS1_6_E08.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_6_E08_A034 5', mRNA sequence
Length = 826
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 641 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 683
>gb|DR047460.1|DR047460 RTBOR1_1_E07.b1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_1_E07_A029 3', mRNA sequence
Length = 767
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 207 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 249
>gb|DR078300.1|DR078300 RTFEPL1_3_E07.b1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_3_E07_A029 3', mRNA sequence
Length = 783
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 383 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 425
>gb|DR078368.1|DR078368 RTFEPL1_3_E07.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_3_E07_A029 5', mRNA sequence
Length = 712
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 614 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 656
>gb|DR078441.1|DR078441 RTFEPL1_4_E07.b1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_4_E07_A029 3', mRNA sequence
Length = 338
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 19 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 61
>gb|DR081137.1|DR081137 RTFEPL1_27_E02.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_27_E02_A029 5', mRNA sequence
Length = 821
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 624 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 666
>gb|DR109623.1|DR109623 RTS1_3_C05.g1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_3_C05_A029 5', mRNA sequence
Length = 762
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 571 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 529
>gb|DR116719.1|DR116719 RTMG1_2_H06.b1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_2_H06_A029 3', mRNA sequence
Length = 846
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 283 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 241
>gb|DR116804.1|DR116804 RTMG1_2_H06.g1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_2_H06_A029 5', mRNA sequence
Length = 838
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 552 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 510
>gb|DR168155.1|DR168155 RTPHOS1_23_C06.g1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_23_C06_A029 5', mRNA sequence
Length = 612
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 429 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 387
>gb|DR683816.1|DR683816 EST1073892 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAAL61 3' end, mRNA sequence
Length = 803
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 503 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 461
>gb|DR694258.1|DR694258 EST1084349 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAEA11 3' end, mRNA sequence
Length = 766
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 562 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 520
>gb|DR695125.1|DR695125 EST1085218 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAEK79 3' end, mRNA sequence
Length = 820
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 381 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 339
>gb|DR744517.1|DR744517 RTCU1_23_B05.b1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_23_B05_A029 3', mRNA sequence
Length = 789
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 85 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 43
>gb|DT631539.1|DT631539 EST1146470 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMF984 3' end, mRNA sequence
Length = 815
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 511 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 469
>gb|DT638590.1|DT638590 EST1153521 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMHH03 3' end, mRNA sequence
Length = 841
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 670 tgaacagctggtcgaagtgaggcctgcagtagagcactccctc 712
|||| |||||||| ||||||||| |||| || |||||||||||
Sbjct: 570 tgaaaagctggtcaaagtgaggcttgcaatatagcactccctc 528
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 120,554
Number of Sequences: 355925
Number of extensions: 120554
Number of successful extensions: 31036
Number of sequences better than 0.5: 66
Number of HSP's better than 0.5 without gapping: 66
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 30818
Number of HSP's gapped (non-prelim): 218
length of query: 950
length of database: 217,277,237
effective HSP length: 19
effective length of query: 931
effective length of database: 210,514,662
effective search space: 195989150322
effective search space used: 195989150322
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)