BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1804958.2.1
(1118 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BG040229.1|BG040229 NXSI_110_A07_F NXSI (Nsf Xylem Side ... 141 7e-032
gb|CF389519.1|CF389519 RTDR2_8_B11.b1_A021 Loblolly pine ro... 141 7e-032
gb|CO365327.1|CO365327 RTK1_25_B06.b1_A029 Roots minus pota... 141 7e-032
gb|CO365443.1|CO365443 RTK1_17_C10.b1_A029 Roots minus pota... 141 7e-032
gb|CO365529.1|CO365529 RTK1_17_C10.g1_A029 Roots minus pota... 141 7e-032
gb|CO369002.1|CO369002 RTK1_44_F12.b1_A029 Roots minus pota... 141 7e-032
gb|DR017548.1|DR017548 STRS1_17_B02.b1_A034 Shoot tip pitch... 141 7e-032
gb|DR017625.1|DR017625 STRS1_17_B02.g1_A034 Shoot tip pitch... 141 7e-032
gb|DR091080.1|DR091080 RTAL1_19_F09.b1_A029 Roots plus adde... 141 7e-032
gb|DR091162.1|DR091162 RTAL1_19_F09.g1_A029 Roots plus adde... 141 7e-032
gb|DR166003.1|DR166003 RTPHOS1_8_E04.g1_A029 Roots minus ph... 141 7e-032
gb|CO363849.1|CO363849 RTK1_12_E06.b1_A029 Roots minus pota... 133 2e-029
gb|CO365399.1|CO365399 RTK1_25_B06.g1_A029 Roots minus pota... 133 2e-029
gb|CF670190.1|CF670190 RTCNT1_48_D08.g1_A029 Root control P... 131 7e-029
gb|AI725280.1|AI725280 1146 PtIFG2 Pinus taeda cDNA clone 9... 125 4e-027
gb|CF393001.1|CF393001 RTDR3_18_E12.g1_A022 Loblolly pine r... 117 1e-024
gb|CO369078.1|CO369078 RTK1_44_F12.g1_A029 Roots minus pota... 117 1e-024
gb|BG317563.1|BG317563 NXPV_003_C07_F NXPV (Nsf Xylem Plani... 111 6e-023
gb|DR053203.1|DR053203 RTCA1_9_D06.g1_A029 Roots minus calc... 109 2e-022
gb|DR095290.1|DR095290 STRR1_20_C06.b1_A033 Stem Response R... 105 4e-021
gb|DR097217.1|DR097217 STRR1_33_G07.b1_A033 Stem Response R... 105 4e-021
gb|DR177283.1|DR177283 RTMNUT1_4_H01.b1_A029 Roots minus mi... 94 1e-017
gb|BX679820.1|BX679820 BX679820 RS Pinus pinaster cDNA clon... 86 4e-015
gb|DR053121.1|DR053121 RTCA1_9_D06.b1_A029 Roots minus calc... 74 1e-011
gb|DR097306.1|DR097306 STRR1_33_G07.g3_A033 Stem Response R... 74 1e-011
gb|DR095364.1|DR095364 STRR1_20_C06.g1_A033 Stem Response R... 62 5e-008
gb|CR392268.1|CR392268 CR392268 RN Pinus pinaster cDNA clon... 58 8e-007
gb|CF389628.1|CF389628 RTDR2_8_B11.g1_A021 Loblolly pine ro... 54 1e-005
gb|DT638906.1|DT638906 EST1153837 Normalized pine embryo li... 54 1e-005
gb|CO368589.1|CO368589 RTK1_41_C07.g1_A029 Roots minus pota... 44 0.012
gb|CX651686.1|CX651686 COLD1_54_D03.b1_A029 Root cold Pinus... 44 0.012
gb|CX651761.1|CX651761 COLD1_54_D03.g1_A029 Root cold Pinus... 44 0.012
gb|DR019332.1|DR019332 STRS1_29_F12.b1_A034 Shoot tip pitch... 44 0.012
gb|DR081033.1|DR081033 RTFEPL1_26_H08.g1_A029 Roots plus ad... 44 0.012
gb|DR694441.1|DR694441 EST1084533 Normalized pine embryo li... 44 0.012
gb|DR694995.1|DR694995 EST1085088 Normalized pine embryo li... 42 0.048
gb|CO163807.1|CO163807 FLD1_43_H10.g1_A029 Root flooded Pin... 40 0.19
>gb|BG040229.1|BG040229 NXSI_110_A07_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_110_A07 5' similar to Arabidopsis thaliana
sequence At1g48410 Argonaute protein AGO1 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 578
Score = 141 bits (71), Expect = 7e-032
Identities = 224/275 (81%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 74 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 133
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 134 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 193
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | |||||||| | ||||||
Sbjct: 194 tgggatgaaaacaaattcacagctgatggattgcagtccttaaccaacaatctctgttac 253
Query: 697 acgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactatgctcacctg 756
|| ||||| ||||||||||| ||||| || || || || || || || ||||| || |||
Sbjct: 254 acatatgcgaggtgcacacggtcagtttctatagtacccccagcgtattatgcccatctg 313
Query: 757 gcagccttccgagctcggttctacatggagccaga 791
|| || || || |||||||| || |||||||||||
Sbjct: 314 gctgcatttcgggctcggttttatatggagccaga 348
>gb|CF389519.1|CF389519 RTDR2_8_B11.b1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_8_B11_A021 3', mRNA
sequence
Length = 645
Score = 141 bits (71), Expect = 7e-032
Identities = 224/275 (81%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 23 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 82
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 83 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 142
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | |||||||| | ||||||
Sbjct: 143 tgggatgaaaacaaattcacagctgatggattgcagtccttaaccaacaatctctgttac 202
Query: 697 acgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactatgctcacctg 756
|| ||||| ||||||||||| ||||| || || || || || || || ||||| || |||
Sbjct: 203 acatatgcgaggtgcacacggtcagtttctatagtacccccagcgtattatgcccatctg 262
Query: 757 gcagccttccgagctcggttctacatggagccaga 791
|| || || || |||||||| || |||||||||||
Sbjct: 263 gctgcatttcgggctcggttttatatggagccaga 297
>gb|CO365327.1|CO365327 RTK1_25_B06.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_25_B06_A029 3', mRNA sequence
Length = 755
Score = 141 bits (71), Expect = 7e-032
Identities = 224/275 (81%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 45 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 104
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 105 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 164
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | || ||||| || ||||||
Sbjct: 165 tgggatgaaaacaaattcacagctgatggattgcagtccttaactaacaatttctgttac 224
Query: 697 acgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactatgctcacctg 756
|| ||||| ||||||||||| ||||| || || || || || || || ||||| || |||
Sbjct: 225 acatatgcgaggtgcacacggtcagtttctatagtacccccagcgtattatgcccatctg 284
Query: 757 gcagccttccgagctcggttctacatggagccaga 791
|| || || || |||||||| || |||||||||||
Sbjct: 285 gctgcatttcgggctcggttttatatggagccaga 319
>gb|CO365443.1|CO365443 RTK1_17_C10.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_17_C10_A029 3', mRNA sequence
Length = 871
Score = 141 bits (71), Expect = 7e-032
Identities = 224/275 (81%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 150 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 209
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 210 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 269
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | |||||||| | ||||||
Sbjct: 270 tgggatgaaaacaaattcacagctgatggattgcagtccttaaccaacaatctctgttac 329
Query: 697 acgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactatgctcacctg 756
|| ||||| ||||||||||| ||||| || || || || || || || ||||| || |||
Sbjct: 330 acatatgcgaggtgcacacggtcagtttctatagtacccccagcgtattatgcccatctg 389
Query: 757 gcagccttccgagctcggttctacatggagccaga 791
|| || || || |||||||| || |||||||||||
Sbjct: 390 gctgcatttcgggctcggttttatatggagccaga 424
>gb|CO365529.1|CO365529 RTK1_17_C10.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_17_C10_A029 5', mRNA sequence
Length = 831
Score = 141 bits (71), Expect = 7e-032
Identities = 224/275 (81%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 467 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 526
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 527 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 586
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | |||||||| | ||||||
Sbjct: 587 tgggatgaaaacaaattcacagctgatggattgcagtccttaaccaacaatctctgttac 646
Query: 697 acgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactatgctcacctg 756
|| ||||| ||||||||||| ||||| || || || || || || || ||||| || |||
Sbjct: 647 acatatgcgaggtgcacacggtcagtttctatagtacccccagcgtattatgcccatctg 706
Query: 757 gcagccttccgagctcggttctacatggagccaga 791
|| || || || |||||||| || |||||||||||
Sbjct: 707 gctgcatttcgggctcggttttatatggagccaga 741
Score = 54.0 bits (27), Expect = 1e-005
Identities = 69/83 (83%)
Strand = Plus / Plus
Query: 319 atattctacagggatggcgtcagtgagggacaattctaccaagttctgttgtatgaactt 378
||||| ||||| ||||| || || ||||| || || || ||||||||||||||||| |
Sbjct: 269 atattttacagagatggagtaagcgagggccagttttatcaagttctgttgtatgagtta 328
Query: 379 gatgccattagaaaggcctgtgc 401
||||| ||| |||||||||||||
Sbjct: 329 gatgctattcgaaaggcctgtgc 351
>gb|CO369002.1|CO369002 RTK1_44_F12.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_44_F12_A029 3', mRNA sequence
Length = 823
Score = 141 bits (71), Expect = 7e-032
Identities = 224/275 (81%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 107 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 166
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 167 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 226
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | |||||||| | ||||||
Sbjct: 227 tgggatgaaaacaaattcacagctgatggattgcagtccttaaccaacaatctctgttac 286
Query: 697 acgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactatgctcacctg 756
|| ||||| ||||||||||| ||||| || || || || || || || ||||| || |||
Sbjct: 287 acatatgcgaggtgcacacggtcagtttctatagtacccccagcgtattatgcccatctg 346
Query: 757 gcagccttccgagctcggttctacatggagccaga 791
|| || || || |||||||| || |||||||||||
Sbjct: 347 gctgcatttcgggctcggttttatatggagccaga 381
>gb|DR017548.1|DR017548 STRS1_17_B02.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_17_B02_A034 3', mRNA sequence
Length = 759
Score = 141 bits (71), Expect = 7e-032
Identities = 224/275 (81%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 54 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 113
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 114 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 173
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | |||||||| | ||||||
Sbjct: 174 tgggatgaaaacaaattcacagctgatggattgcagtccttaaccaacaatctctgttac 233
Query: 697 acgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactatgctcacctg 756
|| ||||| ||||||||||| ||||| || || || || || || || ||||| || |||
Sbjct: 234 acatatgcgaggtgcacacggtcagtttctatagtacccccagcgtattatgcccatctg 293
Query: 757 gcagccttccgagctcggttctacatggagccaga 791
|| || || || |||||||| || |||||||||||
Sbjct: 294 gctgcatttcgggctcggttttatatggagccaga 328
>gb|DR017625.1|DR017625 STRS1_17_B02.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_17_B02_A034 5', mRNA sequence
Length = 626
Score = 141 bits (71), Expect = 7e-032
Identities = 224/275 (81%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 239 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 298
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 299 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 358
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | |||||||| | ||||||
Sbjct: 359 tgggatgaaaacaaattcacagctgatggattgcagtccttaaccaacaatctctgttac 418
Query: 697 acgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactatgctcacctg 756
|| ||||| ||||||||||| ||||| || || || || || || || ||||| || |||
Sbjct: 419 acatatgcgaggtgcacacggtcagtttctatagtacccccagcgtattatgcccatctg 478
Query: 757 gcagccttccgagctcggttctacatggagccaga 791
|| || || || |||||||| || |||||||||||
Sbjct: 479 gctgcatttcgggctcggttttatatggagccaga 513
Score = 54.0 bits (27), Expect = 1e-005
Identities = 69/83 (83%)
Strand = Plus / Plus
Query: 319 atattctacagggatggcgtcagtgagggacaattctaccaagttctgttgtatgaactt 378
||||| ||||| ||||| || || ||||| || || || ||||||||||||||||| |
Sbjct: 41 atattttacagagatggagtaagcgagggccagttttatcaagttctgttgtatgagtta 100
Query: 379 gatgccattagaaaggcctgtgc 401
||||| ||| |||||||||||||
Sbjct: 101 gatgctattcgaaaggcctgtgc 123
>gb|DR091080.1|DR091080 RTAL1_19_F09.b1_A029 Roots plus added aluminum Pinus taeda cDNA
clone RTAL1_19_F09_A029 3', mRNA sequence
Length = 741
Score = 141 bits (71), Expect = 7e-032
Identities = 224/275 (81%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 31 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 90
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 91 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 150
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | |||||||| | ||||||
Sbjct: 151 tgggatgaaaacaaattcacagctgatggattgcagtccttaaccaacaatctctgttac 210
Query: 697 acgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactatgctcacctg 756
|| ||||| ||||||||||| ||||| || || || || || || || ||||| || |||
Sbjct: 211 acatatgcgaggtgcacacggtcagtttctatagtacccccagcgtattatgcccatctg 270
Query: 757 gcagccttccgagctcggttctacatggagccaga 791
|| || || || |||||||| || |||||||||||
Sbjct: 271 gctgcatttcgggctcggttttatatggagccaga 305
>gb|DR091162.1|DR091162 RTAL1_19_F09.g1_A029 Roots plus added aluminum Pinus taeda cDNA
clone RTAL1_19_F09_A029 5', mRNA sequence
Length = 796
Score = 141 bits (71), Expect = 7e-032
Identities = 224/275 (81%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 273 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 332
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 333 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 392
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | |||||||| | ||||||
Sbjct: 393 tgggatgaaaacaaattcacagctgatggattgcagtccttaaccaacaatctctgttac 452
Query: 697 acgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactatgctcacctg 756
|| ||||| ||||||||||| ||||| || || || || || || || ||||| || |||
Sbjct: 453 acatatgcgaggtgcacacggtcagtttctatagtacccccagcgtattatgcccatctg 512
Query: 757 gcagccttccgagctcggttctacatggagccaga 791
|| || || || |||||||| || |||||||||||
Sbjct: 513 gctgcatttcgggctcggttttatatggagccaga 547
Score = 46.1 bits (23), Expect = 0.003
Identities = 69/83 (83%), Gaps = 1/83 (1%)
Strand = Plus / Plus
Query: 319 atattctacagggatggcgtcagtgagggacaattctaccaagttctgttgtatgaactt 378
||||| ||||| ||||| || || ||||| || || || ||||||||||||||||| |
Sbjct: 76 atattttacagagatggagtaagcgagggccagttttatcaagttctgttgtatgagtta 135
Query: 379 gatgccattagaaaggcctgtgc 401
|||| |||| |||||||||||||
Sbjct: 136 gatg-cattcgaaaggcctgtgc 157
>gb|DR166003.1|DR166003 RTPHOS1_8_E04.g1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_8_E04_A029 5', mRNA sequence
Length = 924
Score = 141 bits (71), Expect = 7e-032
Identities = 224/275 (81%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 429 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 488
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 489 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 548
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | |||||||| | ||||||
Sbjct: 549 tgggatgaaaacaaattcacagctgatggattgcagtccttaaccaacaatctctgttac 608
Query: 697 acgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactatgctcacctg 756
|| ||||| ||||||||||| ||||| || || || || || || || ||||| || |||
Sbjct: 609 acatatgcgaggtgcacacggtcagtttctatagtacccccagcgtattatgcccatctg 668
Query: 757 gcagccttccgagctcggttctacatggagccaga 791
|| || || || |||||||| || |||||||||||
Sbjct: 669 gctgcatttcgggctcggttttatatggagccaga 703
Score = 54.0 bits (27), Expect = 1e-005
Identities = 69/83 (83%)
Strand = Plus / Plus
Query: 319 atattctacagggatggcgtcagtgagggacaattctaccaagttctgttgtatgaactt 378
||||| ||||| ||||| || || ||||| || || || ||||||||||||||||| |
Sbjct: 231 atattttacagagatggagtaagcgagggccagttttatcaagttctgttgtatgagtta 290
Query: 379 gatgccattagaaaggcctgtgc 401
||||| ||| |||||||||||||
Sbjct: 291 gatgctattcgaaaggcctgtgc 313
>gb|CO363849.1|CO363849 RTK1_12_E06.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_12_E06_A029 3', mRNA sequence
Length = 900
Score = 133 bits (67), Expect = 2e-029
Identities = 223/275 (81%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 195 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 254
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 255 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 314
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | || ||||| | ||||||
Sbjct: 315 tgggatgaaaacaaattcacagctgatggattgcagtccttaactaacaatctctgttac 374
Query: 697 acgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactatgctcacctg 756
|| ||||| ||||||||||| ||||| || || || || || || || ||||| || |||
Sbjct: 375 acatatgcgaggtgcacacggtcagtttctatagtacccccagcgtattatgcccatctg 434
Query: 757 gcagccttccgagctcggttctacatggagccaga 791
|| || || || |||||||| || |||||||||||
Sbjct: 435 gctgcatttcgggctcggttttatatggagccaga 469
Score = 50.1 bits (25), Expect = 2e-004
Identities = 64/77 (83%)
Strand = Plus / Plus
Query: 325 tacagggatggcgtcagtgagggacaattctaccaagttctgttgtatgaacttgatgcc 384
||||| ||||| || || ||||| || || || ||||||||||||||||| | |||||
Sbjct: 3 tacagagatggagtaagcgagggccagttttatcaagttctgttgtatgagttagatgct 62
Query: 385 attagaaaggcctgtgc 401
||| |||||||||||||
Sbjct: 63 attcgaaaggcctgtgc 79
>gb|CO365399.1|CO365399 RTK1_25_B06.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_25_B06_A029 5', mRNA sequence
Length = 845
Score = 133 bits (67), Expect = 2e-029
Identities = 223/275 (81%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 296 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 355
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 356 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 415
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | || ||||| | ||||||
Sbjct: 416 tgggatgaaaacaaattcacagctgatggattgcagtccttaactaacaatctctgttac 475
Query: 697 acgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactatgctcacctg 756
|| ||||| ||||||||||| ||||| || || || || || || || ||||| || |||
Sbjct: 476 acatatgcgaggtgcacacggtcagtttctatagtacccccagcgtattatgcccatctg 535
Query: 757 gcagccttccgagctcggttctacatggagccaga 791
|| || || || |||||||| || |||||||||||
Sbjct: 536 gctgcatttcgggctcggttttatatggagccaga 570
Score = 54.0 bits (27), Expect = 1e-005
Identities = 69/83 (83%)
Strand = Plus / Plus
Query: 319 atattctacagggatggcgtcagtgagggacaattctaccaagttctgttgtatgaactt 378
||||| ||||| ||||| || || ||||| || || || ||||||||||||||||| |
Sbjct: 98 atattttacagagatggagtaagcgagggccagttttatcaagttctgttgtatgagtta 157
Query: 379 gatgccattagaaaggcctgtgc 401
||||| ||| |||||||||||||
Sbjct: 158 gatgctattcgaaaggcctgtgc 180
>gb|CF670190.1|CF670190 RTCNT1_48_D08.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_48_D08_A029 5', mRNA sequence
Length = 797
Score = 131 bits (66), Expect = 7e-029
Identities = 171/206 (83%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 531 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 590
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 591 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 650
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | |||||||| | ||||||
Sbjct: 651 tgggatgaaaacaaattcacagctgatggattgcagtccttaaccaacaatctctgttac 710
Query: 697 acgtatgctaggtgcacacgctcagt 722
|| ||||| ||||||||||| |||||
Sbjct: 711 acatatgcgaggtgcacacggtcagt 736
Score = 54.0 bits (27), Expect = 1e-005
Identities = 69/83 (83%)
Strand = Plus / Plus
Query: 319 atattctacagggatggcgtcagtgagggacaattctaccaagttctgttgtatgaactt 378
||||| ||||| ||||| || || ||||| || || || ||||||||||||||||| |
Sbjct: 333 atattttacagagatggagtaagcgagggccagttttatcaagttctgttgtatgagtta 392
Query: 379 gatgccattagaaaggcctgtgc 401
||||| ||| |||||||||||||
Sbjct: 393 gatgctattcgaaaggcctgtgc 415
>gb|AI725280.1|AI725280 1146 PtIFG2 Pinus taeda cDNA clone 9201r, mRNA sequence
Length = 580
Score = 125 bits (63), Expect = 4e-027
Identities = 170/206 (82%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| |||| || || || ||||||||||| || ||||| ||
Sbjct: 112 aacatattgccaggcactgtantggattccaaaatttgccatccaacagaatttgacttt 171
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 172 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 231
Query: 637 tgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttac 696
|||||||| ||||| || || |||||||| ||||| | | |||||||| | ||||||
Sbjct: 232 tgggatgaaaacaaattcacagctgatggattgcagtccttaaccaacaatctctgttac 291
Query: 697 acgtatgctaggtgcacacgctcagt 722
|| ||||| ||||||||||| |||||
Sbjct: 292 acatatgcgaggtgcacacggtcagt 317
>gb|CF393001.1|CF393001 RTDR3_18_E12.g1_A022 Loblolly pine roots recovering from drought
DR3 Pinus taeda cDNA clone RTDR3_18_E12_A022 5', mRNA
sequence
Length = 748
Score = 117 bits (59), Expect = 1e-024
Identities = 131/155 (84%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 570 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 629
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 630 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 689
Query: 637 tgggatgagaacaactttacggctgatgggttgca 671
|||||||| ||||| || || |||||||| |||||
Sbjct: 690 tgggatgaaaacaaattcacagctgatggattgca 724
Score = 54.0 bits (27), Expect = 1e-005
Identities = 69/83 (83%)
Strand = Plus / Plus
Query: 319 atattctacagggatggcgtcagtgagggacaattctaccaagttctgttgtatgaactt 378
||||| ||||| ||||| || || ||||| || || || ||||||||||||||||| |
Sbjct: 372 atattttacagagatggagtaagcgagggccagttttatcaagttctgttgtatgagtta 431
Query: 379 gatgccattagaaaggcctgtgc 401
||||| ||| |||||||||||||
Sbjct: 432 gatgctattcgaaaggcctgtgc 454
>gb|CO369078.1|CO369078 RTK1_44_F12.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_44_F12_A029 5', mRNA sequence
Length = 779
Score = 117 bits (59), Expect = 1e-024
Identities = 131/155 (84%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 604 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 663
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 664 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 723
Query: 637 tgggatgagaacaactttacggctgatgggttgca 671
|||||||| ||||| || || |||||||| |||||
Sbjct: 724 tgggatgaaaacaaattcacagctgatggattgca 758
Score = 54.0 bits (27), Expect = 1e-005
Identities = 69/83 (83%)
Strand = Plus / Plus
Query: 319 atattctacagggatggcgtcagtgagggacaattctaccaagttctgttgtatgaactt 378
||||| ||||| ||||| || || ||||| || || || ||||||||||||||||| |
Sbjct: 406 atattttacagagatggagtaagcgagggccagttttatcaagttctgttgtatgagtta 465
Query: 379 gatgccattagaaaggcctgtgc 401
||||| ||| |||||||||||||
Sbjct: 466 gatgctattcgaaaggcctgtgc 488
>gb|BG317563.1|BG317563 NXPV_003_C07_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_003_C07 5' similar to Arabidopsis
thaliana sequence At1g48410 Argonaute protein AGO1 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 332
Score = 111 bits (56), Expect = 6e-023
Identities = 182/224 (81%)
Strand = Plus / Plus
Query: 568 tttgatttctacctgtgcagccatgctggcattcagggaacaagccgccctgcccattac 627
||||| || ||||| |||||||||||||| ||||||||||| || | |||||||||||
Sbjct: 6 tttgacttttacctctgcagccatgctggtattcagggaactagtaggcctgcccattat 65
Query: 628 catgttctgtgggatgagaacaactttacggctgatgggttgcaaactctcaccaacaac 687
|||||||| |||||||| ||||| || || |||||||| ||||| | | ||||||||
Sbjct: 66 catgttctttgggatgaaaacaaattcacagctgatggattgcagtccttaaccaacaat 125
Query: 688 ttgtgttacacgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactat 747
| |||||||| ||||| ||||||||||| ||||| || || || || || || || |||
Sbjct: 126 ctctgttacacatatgcgaggtgcacacggtcagtttctatagtacccccagcgtattat 185
Query: 748 gctcacctggcagccttccgagctcggttctacatggagccaga 791
|| || ||||| || || || |||||||| || |||||||||||
Sbjct: 186 gcccatctggctgcatttcgggctcggttttatatggagccaga 229
>gb|DR053203.1|DR053203 RTCA1_9_D06.g1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_9_D06_A029 5', mRNA sequence
Length = 708
Score = 109 bits (55), Expect = 2e-022
Identities = 124/147 (84%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 562 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 621
Query: 577 tacctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctg 636
||||| |||||||||||||| ||||||||||| || | ||||||||||| ||||||||
Sbjct: 622 tacctctgcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctt 681
Query: 637 tgggatgagaacaactttacggctgat 663
|||||||| ||||| || || ||||||
Sbjct: 682 tgggatgaaaacaaattcacagctgat 708
Score = 54.0 bits (27), Expect = 1e-005
Identities = 69/83 (83%)
Strand = Plus / Plus
Query: 319 atattctacagggatggcgtcagtgagggacaattctaccaagttctgttgtatgaactt 378
||||| ||||| ||||| || || ||||| || || || ||||||||||||||||| |
Sbjct: 364 atattttacagagatggagtaagcgagggccagttttatcaagttctgttgtatgagtta 423
Query: 379 gatgccattagaaaggcctgtgc 401
||||| ||| |||||||||||||
Sbjct: 424 gatgctattcgaaaggcctgtgc 446
>gb|DR095290.1|DR095290 STRR1_20_C06.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_20_C06_A033 3', mRNA sequence
Length = 806
Score = 105 bits (53), Expect = 4e-021
Identities = 80/89 (89%)
Strand = Plus / Plus
Query: 556 catccaactgagtttgatttctacctgtgcagccatgctggcattcagggaacaagccgc 615
|||||||| ||||||||||||||||| ||||| |||||||| ||||||||||||||| |
Sbjct: 231 catccaacagagtttgatttctacctttgcagtcatgctggtattcagggaacaagcagg 290
Query: 616 cctgcccattaccatgttctgtgggatga 644
|| || ||||| |||||||||||||||||
Sbjct: 291 ccagctcattatcatgttctgtgggatga 319
Score = 46.1 bits (23), Expect = 0.003
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 898 aaggaaaacgtgaagcgggtcatgttctactgcta 932
|||||||| |||||| |||| ||||||||||||||
Sbjct: 591 aaggaaaatgtgaagagggttatgttctactgcta 625
>gb|DR097217.1|DR097217 STRR1_33_G07.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_33_G07_A033 3', mRNA sequence
Length = 857
Score = 105 bits (53), Expect = 4e-021
Identities = 80/89 (89%)
Strand = Plus / Plus
Query: 556 catccaactgagtttgatttctacctgtgcagccatgctggcattcagggaacaagccgc 615
|||||||| ||||||||||||||||| ||||| |||||||| ||||||||||||||| |
Sbjct: 190 catccaaccgagtttgatttctacctttgcagtcatgctggtattcagggaacaagcagg 249
Query: 616 cctgcccattaccatgttctgtgggatga 644
|| || ||||| |||||||||||||||||
Sbjct: 250 ccagctcattatcatgttctgtgggatga 278
>gb|DR177283.1|DR177283 RTMNUT1_4_H01.b1_A029 Roots minus micronutrients Pinus taeda cDNA
clone RTMNUT1_4_H01_A029 3', mRNA sequence
Length = 637
Score = 93.7 bits (47), Expect = 1e-017
Identities = 116/139 (83%)
Strand = Plus / Plus
Query: 584 gcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctgtgggatg 643
||||||||||||| ||||||||||| || | ||||||||||| |||||||| |||||||
Sbjct: 1 gcagccatgctggtattcagggaactagtaggcctgcccattatcatgttctttgggatg 60
Query: 644 agaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttacacgtatg 703
| ||||| || || |||||||| ||||| | | |||||||| | |||||||| ||||
Sbjct: 61 aaaacaaattcacagctgatggattgcagtccttaaccaacaatctctgttacacatatg 120
Query: 704 ctaggtgcacacgctcagt 722
| ||||||||||| |||||
Sbjct: 121 cgaggtgcacacggtcagt 139
>gb|BX679820.1|BX679820 BX679820 RS Pinus pinaster cDNA clone RS34D06, mRNA sequence
Length = 646
Score = 85.7 bits (43), Expect = 4e-015
Identities = 171/214 (79%)
Strand = Plus / Plus
Query: 578 acctgtgcagccatgctggcattcagggaacaagccgccctgcccattaccatgttctgt 637
|||| |||||||||||||| || |||||||| || | ||||||||||| ||||| || |
Sbjct: 382 acctctgcagccatgctggtatccagggaactagtaggcctgcccattatcatgtncttt 441
Query: 638 gggatgagaacaactttacggctgatgggttgcaaactctcaccaacaacttgtgttaca 697
||||||| ||||| || || |||||||| ||||| | | |||||||| | |||||||
Sbjct: 442 gggatgaaaacaaattcacagctgatggattgcagtccttaaccaacaatctctgttaca 501
Query: 698 cgtatgctaggtgcacacgctcagtatcgattgttcctcctgcatactatgctcacctgg 757
| ||||| ||||||||||| ||||| || || || | || || || ||||| || ||||
Sbjct: 502 catatgcgaggtgcacacggtcagtttctatagtaaccccagcgtattatgcccatctgg 561
Query: 758 cagccttccgagctcggttctacatggagccaga 791
| || || || |||||||| || |||||||||||
Sbjct: 562 ctgcatttcgggctcggttttatatggagccaga 595
>gb|DR053121.1|DR053121 RTCA1_9_D06.b1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_9_D06_A029 3', mRNA sequence
Length = 621
Score = 73.8 bits (37), Expect = 1e-011
Identities = 139/173 (80%)
Strand = Plus / Plus
Query: 619 gcccattaccatgttctgtgggatgagaacaactttacggctgatgggttgcaaactctc 678
|||||||| |||||||| |||||||| ||||| || || |||||||| ||||| | |
Sbjct: 1 gcccattatcatgttctttgggatgaaaacaaattcacagctgatggattgcagtcctta 60
Query: 679 accaacaacttgtgttacacgtatgctaggtgcacacgctcagtatcgattgttcctcct 738
|||||||| | |||||||| ||||| ||||||||||| ||||| || || || || ||
Sbjct: 61 accaacaatctctgttacacatatgcgaggtgcacacggtcagtttctatagtaccccca 120
Query: 739 gcatactatgctcacctggcagccttccgagctcggttctacatggagccaga 791
|| || ||||| || ||||| || || || |||||||| || |||||||||||
Sbjct: 121 gcgtattatgcccatctggctgcatttcgggctcggttttatatggagccaga 173
>gb|DR097306.1|DR097306 STRR1_33_G07.g3_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_33_G07_A033 5', mRNA sequence
Length = 840
Score = 73.8 bits (37), Expect = 1e-011
Identities = 76/89 (85%)
Strand = Plus / Plus
Query: 556 catccaactgagtttgatttctacctgtgcagccatgctggcattcagggaacaagccgc 615
|||||||| || || ||||||||||| ||||| |||||||| ||||| |||||||||
Sbjct: 374 catccaaccgaattagatttctacctttgcagtcatgctggtattcatggaacaagcacg 433
Query: 616 cctgcccattaccatgttctgtgggatga 644
|| || ||||| |||||||||||||||||
Sbjct: 434 ccagctcattatcatgttctgtgggatga 462
>gb|DR095364.1|DR095364 STRR1_20_C06.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_20_C06_A033 5', mRNA sequence
Length = 870
Score = 61.9 bits (31), Expect = 5e-008
Identities = 61/71 (85%)
Strand = Plus / Plus
Query: 292 gcaactggacagaaaccaaagaggatcatattctacagggatggcgtcagtgagggacaa 351
||||| || |||||||| ||||||||||| |||||||| ||||| || |||||||| ||
Sbjct: 563 gcaacaggtcagaaacctaagaggatcatcttctacagagatggtgtaagtgaggggcag 622
Query: 352 ttctaccaagt 362
|| ||||||||
Sbjct: 623 ttttaccaagt 633
Score = 58.0 bits (29), Expect = 8e-007
Identities = 38/41 (92%)
Strand = Plus / Plus
Query: 556 catccaactgagtttgatttctacctgtgcagccatgctgg 596
|||||||| ||||||||||||||||| ||||| ||||||||
Sbjct: 827 catccaacagagtttgatttctacctttgcagtcatgctgg 867
>gb|CR392268.1|CR392268 CR392268 RN Pinus pinaster cDNA clone RN30B12, mRNA sequence
Length = 151
Score = 58.0 bits (29), Expect = 8e-007
Identities = 65/77 (84%)
Strand = Plus / Plus
Query: 517 aacatactgcctggcactgtggtggactcgaagatctgccatccaactgagtttgatttc 576
|||||| |||| |||||||| ||||| || || || ||||||||||| || ||||| ||
Sbjct: 75 aacatattgccaggcactgtagtggattccaaaatttgccatccaacagaatttgacttt 134
Query: 577 tacctgtgcagccatgc 593
||||| |||||||||||
Sbjct: 135 tacctctgcagccatgc 151
>gb|CF389628.1|CF389628 RTDR2_8_B11.g1_A021 Loblolly pine roots recovering from drought DR2
Pinus taeda cDNA clone RTDR2_8_B11_A021 5', mRNA
sequence
Length = 744
Score = 54.0 bits (27), Expect = 1e-005
Identities = 69/83 (83%)
Strand = Plus / Plus
Query: 319 atattctacagggatggcgtcagtgagggacaattctaccaagttctgttgtatgaactt 378
||||| ||||| ||||| || || ||||| || || || ||||||||||||||||| |
Sbjct: 500 atattttacagagatggagtaagcgagggccagttttatcaagttctgttgtatgagtta 559
Query: 379 gatgccattagaaaggcctgtgc 401
||||| ||| |||||||||||||
Sbjct: 560 gatgctattcgaaaggcctgtgc 582
>gb|DT638906.1|DT638906 EST1153837 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMHK80 3' end, mRNA sequence
Length = 819
Score = 54.0 bits (27), Expect = 1e-005
Identities = 69/83 (83%)
Strand = Plus / Plus
Query: 319 atattctacagggatggcgtcagtgagggacaattctaccaagttctgttgtatgaactt 378
||||| ||||| ||||| || || ||||| || || || ||||||||||||||||| |
Sbjct: 690 atattttacagagatggagtaagcgagggccagttttatcaagttctgttgtatgagtta 749
Query: 379 gatgccattagaaaggcctgtgc 401
||||| ||| |||||||||||||
Sbjct: 750 gatgctattcgaaaggcctgtgc 772
>gb|CO368589.1|CO368589 RTK1_41_C07.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_41_C07_A029 5', mRNA sequence
Length = 741
Score = 44.1 bits (22), Expect = 0.012
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 566 agtttgatttctacctgtgcagccat 591
||||||||||||| ||||||||||||
Sbjct: 135 agtttgatttctatctgtgcagccat 160
>gb|CX651686.1|CX651686 COLD1_54_D03.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_54_D03_A029 3', mRNA sequence
Length = 686
Score = 44.1 bits (22), Expect = 0.012
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 566 agtttgatttctacctgtgcagccat 591
||||||||||||| ||||||||||||
Sbjct: 416 agtttgatttctatctgtgcagccat 391
>gb|CX651761.1|CX651761 COLD1_54_D03.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_54_D03_A029 5', mRNA sequence
Length = 722
Score = 44.1 bits (22), Expect = 0.012
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 566 agtttgatttctacctgtgcagccat 591
||||||||||||| ||||||||||||
Sbjct: 669 agtttgatttctatctgtgcagccat 644
>gb|DR019332.1|DR019332 STRS1_29_F12.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_29_F12_A034 3', mRNA sequence
Length = 746
Score = 44.1 bits (22), Expect = 0.012
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 566 agtttgatttctacctgtgcagccat 591
||||||||||||| ||||||||||||
Sbjct: 83 agtttgatttctatctgtgcagccat 108
>gb|DR081033.1|DR081033 RTFEPL1_26_H08.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_26_H08_A029 5', mRNA sequence
Length = 113
Score = 44.1 bits (22), Expect = 0.012
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 566 agtttgatttctacctgtgcagccat 591
||||||||||||| ||||||||||||
Sbjct: 15 agtttgatttctatctgtgcagccat 40
>gb|DR694441.1|DR694441 EST1084533 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAEC49 3' end, mRNA sequence
Length = 824
Score = 44.1 bits (22), Expect = 0.012
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 566 agtttgatttctacctgtgcagccat 591
||||||||||||| ||||||||||||
Sbjct: 630 agtttgatttctatctgtgcagccat 655
>gb|DR694995.1|DR694995 EST1085088 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAEJ27 3' end, mRNA sequence
Length = 863
Score = 42.1 bits (21), Expect = 0.048
Identities = 63/77 (81%)
Strand = Plus / Plus
Query: 319 atattctacagggatggcgtcagtgagggacaattctaccaagttctgttgtatgaactt 378
||||| ||||| ||||| || || ||||| || || || ||||||||||||||||| |
Sbjct: 682 atattttacagagatggagtaagcgagggccagttttatcaagttctgttgtatgagtta 741
Query: 379 gatgccattagaaaggc 395
||||| ||| |||||||
Sbjct: 742 gatgctattcgaaaggc 758
>gb|CO163807.1|CO163807 FLD1_43_H10.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_43_H10_A029 5', mRNA sequence
Length = 842
Score = 40.1 bits (20), Expect = 0.19
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 209 atcttttcaaggtatggcaa 228
||||||||||||||||||||
Sbjct: 84 atcttttcaaggtatggcaa 103
Database: Pinus_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:45 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 108,739
Number of Sequences: 355925
Number of extensions: 108739
Number of successful extensions: 29659
Number of sequences better than 0.5: 37
Number of HSP's better than 0.5 without gapping: 37
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29543
Number of HSP's gapped (non-prelim): 98
length of query: 1118
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1099
effective length of database: 210,514,662
effective search space: 231355613538
effective search space used: 231355613538
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)