BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 1804908.2.1
         (1118 letters)

Database: Pinus_nucl_with_EST.fasta 
           355,925 sequences; 217,277,237 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AW784156.1|AW784156  NXNV_103_G10_F Nsf Xylem Normal wood...    40   0.19 
gb|CO362709.1|CO362709  RTK1_5_G10.b1_A029 Roots minus potas...    40   0.19 

>gb|AW784156.1|AW784156 NXNV_103_G10_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
           clone NXNV_103_G10 5', mRNA sequence
          Length = 368

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 797 cctcatgaactctttatctt 816
           ||||||||||||||||||||
Sbjct: 176 cctcatgaactctttatctt 157



>gb|CO362709.1|CO362709 RTK1_5_G10.b1_A029 Roots minus potassium Pinus taeda cDNA clone
           RTK1_5_G10_A029 3', mRNA sequence
          Length = 764

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 656 ttcaccaattttttcaccactatt 679
           ||||||||||||||||||| ||||
Sbjct: 760 ttcaccaattttttcaccattatt 737



  Database: Pinus_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:45 PM
  Number of letters in database: 217,277,237
  Number of sequences in database:  355,925
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 136,481
Number of Sequences: 355925
Number of extensions: 136481
Number of successful extensions: 38151
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38149
Number of HSP's gapped (non-prelim): 2
length of query: 1118
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1099
effective length of database: 210,514,662
effective search space: 231355613538
effective search space used: 231355613538
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)