BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.452
(1348 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE187355.1|BE187355 NXNV_162_H08_F Nsf Xylem Normal wood... 50 2e-004
emb|AJ250467.1|PSY250467 Pinus sylvestris mRNA for receptor... 40 0.23
gb|BX253119.1|BX253119 BX253119 Pinus pinaster differenciat... 36 3.6
gb|BI644020.1|BI644020 NXPV_127_A09_F NXPV (Nsf Xylem Plani... 36 3.6
gb|BQ696069.1|BQ696069 NXPV_036_A08_F NXPV (Nsf Xylem Plani... 36 3.6
gb|CF386717.1|CF386717 RTDR1_16_E08.g1_A015 Loblolly pine r... 36 3.6
gb|CF394146.1|CF394146 RTDS2_3_G11.g1_A021 Drought-stressed... 36 3.6
gb|BX681343.1|BX681343 BX681343 RS Pinus pinaster cDNA clon... 36 3.6
gb|BX681873.1|BX681873 BX681873 RS Pinus pinaster cDNA clon... 36 3.6
gb|CO170261.1|CO170261 NDL1_12_F10.g1_A029 Needles control ... 36 3.6
gb|CO171480.1|CO171480 NDL1_22_A09.b1_A029 Needles control ... 36 3.6
gb|CO200331.1|CO200331 GEO2_6_G03.g1_A032 Root gravitropism... 36 3.6
gb|CO201114.1|CO201114 RTCNT2_3_E12.g1_A029 Root control 2 ... 36 3.6
gb|CO365214.1|CO365214 RTK1_24_G12.b1_A029 Roots minus pota... 36 3.6
gb|CV036128.1|CV036128 RTNACL1_44_H01.g1_A029 Roots plus ad... 36 3.6
gb|CX649202.1|CX649202 COLD1_33_D05.g1_A029 Root cold Pinus... 36 3.6
gb|CX652101.1|CX652101 COLD1_57_A01.b1_A029 Root cold Pinus... 36 3.6
gb|CX652173.1|CX652173 COLD1_57_A01.g1_A029 Root cold Pinus... 36 3.6
gb|CX652228.1|CX652228 COLD1_57_F08.g1_A029 Root cold Pinus... 36 3.6
gb|CX652677.1|CX652677 COLD1_60_F07.g1_A029 Root cold Pinus... 36 3.6
gb|CX712969.1|CX712969 RTPQ1_6_C12.b1_A032 Roots treated wi... 36 3.6
gb|CX713038.1|CX713038 RTPQ1_6_C12.g1_A032 Roots treated wi... 36 3.6
gb|DR051978.1|DR051978 RTCA1_1_D08.g1_A029 Roots minus calc... 36 3.6
gb|DR058480.1|DR058480 RTNIT1_12_B12.b1_A029 Roots minus ni... 36 3.6
gb|DR058555.1|DR058555 RTNIT1_12_B12.g1_A029 Roots minus ni... 36 3.6
gb|DR079189.1|DR079189 RTFEPL1_9_E02.g1_A029 Roots plus add... 36 3.6
gb|DR109631.1|DR109631 RTS1_3_D07.g1_A029 Roots minus sulfu... 36 3.6
gb|DR117450.1|DR117450 RTMG1_7_C01.b1_A029 Roots minus magn... 36 3.6
dbj|BD266924.1| Compositions isolated from plant cells and ... 36 3.6
dbj|BD267346.1| Compositions isolated from plant cells and ... 36 3.6
>gb|BE187355.1|BE187355 NXNV_162_H08_F Nsf Xylem Normal wood Vertical Pinus taeda cDNA
clone NXNV_162_H08 5' similar to Arabidopsis thaliana
sequence At5g47850 receptor kinase-like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 307
Score = 50.1 bits (25), Expect = 2e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 546 tccatggagacatcaagccttccaa 570
|||||||||||||||||||||||||
Sbjct: 31 tccatggagacatcaagccttccaa 55
>emb|AJ250467.1|PSY250467 Pinus sylvestris mRNA for receptor protein kinase (upk gene)
Length = 3889
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcggcgtggt 747
|||||||||||| |||||||||||
Sbjct: 3096 cgatgtctacagtttcggcgtggt 3119
>gb|BX253119.1|BX253119 BX253119 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP078C10, mRNA sequence
Length = 672
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 184 cgatgtctacagcttcgg 201
>gb|BI644020.1|BI644020 NXPV_127_A09_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_127_A09 5' similar to Arabidopsis
thaliana sequence At2g26730 putative receptor-like
protein kinase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 277
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 120 cgatgtctacagcttcgg 137
>gb|BQ696069.1|BQ696069 NXPV_036_A08_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_036_A08 5' similar to Arabidopsis
thaliana sequence At2g26730 putative receptor-like
protein kinase see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 396
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 120 cgatgtctacagcttcgg 137
>gb|CF386717.1|CF386717 RTDR1_16_E08.g1_A015 Loblolly pine roots recovering from drought
DR1 Pinus taeda cDNA clone RTDR1_16_E08_A015 5', mRNA
sequence
Length = 830
Score = 36.2 bits (18), Expect = 3.6
Identities = 30/34 (88%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcggcgtggtgcttctggag 757
|||||| ||||| ||||||||||| || ||||||
Sbjct: 216 cgatgtgtacagtttcggcgtggttctgctggag 249
>gb|CF394146.1|CF394146 RTDS2_3_G11.g1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_3_G11_A021 5', mRNA sequence
Length = 853
Score = 36.2 bits (18), Expect = 3.6
Identities = 30/34 (88%)
Strand = Plus / Plus
Query: 729 tctacagcttcggcgtggtgcttctggagctcat 762
||||||||||||| ||||| | |||||||||||
Sbjct: 427 tctacagcttcggtgtggttttactggagctcat 460
>gb|BX681343.1|BX681343 BX681343 RS Pinus pinaster cDNA clone RS57D03, mRNA sequence
Length = 590
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 501 cgatgtctacagcttcgg 518
>gb|BX681873.1|BX681873 BX681873 RS Pinus pinaster cDNA clone RS66B02, mRNA sequence
Length = 561
Score = 36.2 bits (18), Expect = 3.6
Identities = 33/38 (86%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctc 760
||||||| || || ||||| ||||| ||||||||||||
Sbjct: 327 gcgatgtatatagtttcggtgtggtccttctggagctc 364
>gb|CO170261.1|CO170261 NDL1_12_F10.g1_A029 Needles control Pinus taeda cDNA clone
NDL1_12_F10_A029 5', mRNA sequence
Length = 732
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 59 cgatgtctacagcttcgg 76
>gb|CO171480.1|CO171480 NDL1_22_A09.b1_A029 Needles control Pinus taeda cDNA clone
NDL1_22_A09_A029 3', mRNA sequence
Length = 699
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 65 cgatgtctacagcttcgg 82
>gb|CO200331.1|CO200331 GEO2_6_G03.g1_A032 Root gravitropism October 2003 test Pinus taeda
cDNA clone GEO2_6_G03_A032 5', mRNA sequence
Length = 853
Score = 36.2 bits (18), Expect = 3.6
Identities = 33/38 (86%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctc 760
||||||| || || ||||| ||||| ||||||||||||
Sbjct: 317 gcgatgtatatagtttcggtgtggtccttctggagctc 354
>gb|CO201114.1|CO201114 RTCNT2_3_E12.g1_A029 Root control 2 (late) Pinus taeda cDNA clone
RTCNT2_3_E12_A029 5', mRNA sequence
Length = 702
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 487 cgatgtctacagcttcgg 504
>gb|CO365214.1|CO365214 RTK1_24_G12.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_24_G12_A029 3', mRNA sequence
Length = 850
Score = 36.2 bits (18), Expect = 3.6
Identities = 33/38 (86%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctc 760
||||||| || || ||||| ||||| ||||||||||||
Sbjct: 143 gcgatgtatatagtttcggtgtggtccttctggagctc 180
>gb|CV036128.1|CV036128 RTNACL1_44_H01.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_44_H01_A029 5', mRNA sequence
Length = 803
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 135 cgatgtctacagcttcgg 152
>gb|CX649202.1|CX649202 COLD1_33_D05.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_33_D05_A029 5', mRNA sequence
Length = 806
Score = 36.2 bits (18), Expect = 3.6
Identities = 30/34 (88%)
Strand = Plus / Plus
Query: 729 tctacagcttcggcgtggtgcttctggagctcat 762
||||||||||||| ||||| | |||||||||||
Sbjct: 325 tctacagcttcggtgtggttttactggagctcat 358
>gb|CX652101.1|CX652101 COLD1_57_A01.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_57_A01_A029 3', mRNA sequence
Length = 727
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 72 cgatgtctacagcttcgg 89
>gb|CX652173.1|CX652173 COLD1_57_A01.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_57_A01_A029 5', mRNA sequence
Length = 779
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 172 cgatgtctacagcttcgg 189
>gb|CX652228.1|CX652228 COLD1_57_F08.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_57_F08_A029 5', mRNA sequence
Length = 326
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 209 cgatgtctacagcttcgg 226
>gb|CX652677.1|CX652677 COLD1_60_F07.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_60_F07_A029 5', mRNA sequence
Length = 579
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 250 cgatgtctacagcttcgg 267
>gb|CX712969.1|CX712969 RTPQ1_6_C12.b1_A032 Roots treated with paraquat Pinus taeda cDNA
clone RTPQ1_6_C12_A032 3', mRNA sequence
Length = 871
Score = 36.2 bits (18), Expect = 3.6
Identities = 30/34 (88%)
Strand = Plus / Plus
Query: 729 tctacagcttcggcgtggtgcttctggagctcat 762
||||||||||||| ||||| | |||||||||||
Sbjct: 370 tctacagcttcggtgtggttttactggagctcat 403
>gb|CX713038.1|CX713038 RTPQ1_6_C12.g1_A032 Roots treated with paraquat Pinus taeda cDNA
clone RTPQ1_6_C12_A032 5', mRNA sequence
Length = 850
Score = 36.2 bits (18), Expect = 3.6
Identities = 30/34 (88%)
Strand = Plus / Plus
Query: 729 tctacagcttcggcgtggtgcttctggagctcat 762
||||||||||||| ||||| | |||||||||||
Sbjct: 508 tctacagcttcggtgtggttttactggagctcat 541
>gb|DR051978.1|DR051978 RTCA1_1_D08.g1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_1_D08_A029 5', mRNA sequence
Length = 930
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 515 cgatgtctacagcttcgg 532
>gb|DR058480.1|DR058480 RTNIT1_12_B12.b1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_12_B12_A029 3', mRNA sequence
Length = 733
Score = 36.2 bits (18), Expect = 3.6
Identities = 30/34 (88%)
Strand = Plus / Plus
Query: 729 tctacagcttcggcgtggtgcttctggagctcat 762
||||||||||||| ||||| | |||||||||||
Sbjct: 46 tctacagcttcggtgtggttttactggagctcat 79
>gb|DR058555.1|DR058555 RTNIT1_12_B12.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_12_B12_A029 5', mRNA sequence
Length = 859
Score = 36.2 bits (18), Expect = 3.6
Identities = 30/34 (88%)
Strand = Plus / Plus
Query: 729 tctacagcttcggcgtggtgcttctggagctcat 762
||||||||||||| ||||| | |||||||||||
Sbjct: 521 tctacagcttcggtgtggttttactggagctcat 554
>gb|DR079189.1|DR079189 RTFEPL1_9_E02.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_9_E02_A029 5', mRNA sequence
Length = 835
Score = 36.2 bits (18), Expect = 3.6
Identities = 33/38 (86%)
Strand = Plus / Plus
Query: 723 gcgatgtctacagcttcggcgtggtgcttctggagctc 760
||||||| || || ||||| ||||| ||||||||||||
Sbjct: 765 gcgatgtatatagtttcggtgtggtccttctggagctc 802
>gb|DR109631.1|DR109631 RTS1_3_D07.g1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_3_D07_A029 5', mRNA sequence
Length = 720
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 310 cgatgtctacagcttcgg 327
>gb|DR117450.1|DR117450 RTMG1_7_C01.b1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_7_C01_A029 3', mRNA sequence
Length = 840
Score = 36.2 bits (18), Expect = 3.6
Identities = 30/34 (88%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcggcgtggtgcttctggag 757
|||||| ||||| ||||||||||| || ||||||
Sbjct: 93 cgatgtgtacagtttcggcgtggttctgctggag 126
>dbj|BD266924.1| Compositions isolated from plant cells and utilization of the same in
modifying plant cell signal transduction
Length = 2686
Score = 36.2 bits (18), Expect = 3.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 724 cgatgtctacagcttcgg 741
||||||||||||||||||
Sbjct: 2030 cgatgtctacagcttcgg 2047
>dbj|BD267346.1| Compositions isolated from plant cells and utilization of the same in
modifying plant cell signal transduction
Length = 3222
Score = 36.2 bits (18), Expect = 3.6
Identities = 30/34 (88%)
Strand = Plus / Plus
Query: 729 tctacagcttcggcgtggtgcttctggagctcat 762
||||||||||||| ||||| | |||||||||||
Sbjct: 2589 tctacagcttcggtgtggttttactggagctcat 2622
Database: Pinus_nucl_with_EST.fasta
Posted date: May 2, 2006 3:25 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 149,992
Number of Sequences: 355925
Number of extensions: 149992
Number of successful extensions: 41993
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41961
Number of HSP's gapped (non-prelim): 32
length of query: 1348
length of database: 217,277,237
effective HSP length: 19
effective length of query: 1329
effective length of database: 210,514,662
effective search space: 279773985798
effective search space used: 279773985798
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)