BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.249
(684 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CF670782.1|CF670782 RTCNT1_52_B12.g1_A029 Root control P... 64 8e-009
gb|CX645400.1|CX645400 COLD1_2_B07.g1_A029 Root cold Pinus ... 64 8e-009
gb|DR054781.1|DR054781 RTCA1_19_C01.g1_A029 Roots minus cal... 64 8e-009
gb|CV036580.1|CV036580 RTNACL1_60_F04.b1_A029 Roots plus ad... 62 3e-008
gb|DR020199.1|DR020199 STRS1_35_G03.b1_A034 Shoot tip pitch... 62 3e-008
gb|DR094669.1|DR094669 STRR1_16_B04.b1_A033 Stem Response R... 62 3e-008
gb|DR094743.1|DR094743 STRR1_16_B04.g1_A033 Stem Response R... 62 3e-008
gb|CF474235.1|CF474235 RTWW2_17_A03.g1_A021 Well-watered lo... 60 1e-007
gb|CF671366.1|CF671366 RTCNT1_56_D01.g1_A029 Root control P... 60 1e-007
gb|CO366873.1|CO366873 RTK1_30_E06.g1_A029 Roots minus pota... 60 1e-007
gb|CV036477.1|CV036477 RTNACL1_59_B12.g1_A029 Roots plus ad... 60 1e-007
gb|CV036651.1|CV036651 RTNACL1_60_F04.g1_A029 Roots plus ad... 60 1e-007
gb|CX649684.1|CX649684 COLD1_36_G06.g1_A029 Root cold Pinus... 60 1e-007
gb|DR011689.1|DR011689 HEAT1_7_F11.b1_A029 Root at 37 C for... 60 1e-007
gb|DR011768.1|DR011768 HEAT1_7_F11.g1_A029 Root at 37 C for... 60 1e-007
gb|DR019319.1|DR019319 STRS1_29_E04.b1_A034 Shoot tip pitch... 60 1e-007
gb|DR059746.1|DR059746 RTNIT1_19_C01.g1_A029 Roots minus ni... 60 1e-007
gb|DR089772.1|DR089772 RTAL1_10_E10.g1_A029 Roots plus adde... 60 1e-007
gb|DR119693.1|DR119693 RTMG1_24_G10.g1_A029 Roots minus mag... 60 1e-007
gb|DR743961.1|DR743961 RTCU1_19_G03.b1_A029 Roots plus adde... 60 1e-007
gb|DR102773.1|DR102773 STRR1_83_F05.g1_A033 Stem Response R... 56 2e-006
gb|DR098767.1|DR098767 STRR1_47_F01.g1_A033 Stem Response R... 54 8e-006
gb|BX249163.1|BX249163 BX249163 Pinus pinaster differenciat... 52 3e-005
gb|BX252786.1|BX252786 BX252786 Pinus pinaster differenciat... 52 3e-005
gb|CO366800.1|CO366800 RTK1_30_E06.b1_A029 Roots minus pota... 52 3e-005
gb|DR019591.1|DR019591 STRS1_31_C08.b1_A034 Shoot tip pitch... 52 3e-005
gb|AW755006.1|AW755006 PC09E04 Pine TriplEx pollen cone lib... 44 0.007
gb|BE452000.1|BE452000 NXCI_007_C04_F NXCI (Nsf Xylem Compr... 44 0.007
gb|BF517750.1|BF517750 NXSI_029_G09_F NXSI (Nsf Xylem Side ... 44 0.007
gb|BF777460.1|BF777460 NXSI_071_H02_F NXSI (Nsf Xylem Side ... 44 0.007
gb|BF777931.1|BF777931 NXSI_079_A05_F NXSI (Nsf Xylem Side ... 44 0.007
gb|BF778525.1|BF778525 NXSI_085_G03_F NXSI (Nsf Xylem Side ... 44 0.007
gb|BG040829.1|BG040829 NXSI_115_F01_F NXSI (Nsf Xylem Side ... 44 0.007
gb|BG317490.1|BG317490 NXPV_002_D10_F NXPV (Nsf Xylem Plani... 44 0.007
gb|BI202865.1|BI202865 NXPV_091_E02_F NXPV (Nsf Xylem Plani... 44 0.007
gb|BM427882.1|BM427882 NXRV_005_F01_F NXRV (Nsf Xylem Root ... 44 0.007
gb|BQ291219.1|BQ291219 NXRV057_D08_F NXRV (Nsf Xylem Root w... 44 0.007
gb|BQ634682.1|BQ634682 NXRV072_A03_F NXRV (Nsf Xylem Root w... 44 0.007
gb|BQ697198.1|BQ697198 NXPV_050_F10_F NXPV (Nsf Xylem Plani... 44 0.007
gb|BQ697618.1|BQ697618 NXPV_058_G06_F NXPV (Nsf Xylem Plani... 44 0.007
gb|BQ701178.1|BQ701178 NXSI_023_E02_F NXSI (Nsf Xylem Side ... 44 0.007
gb|CD028507.1|CD028507 NXSI_119_G07_F NXSI (Nsf Xylem Side ... 44 0.007
gb|CF399489.1|CF399489 RTDS3_26_F04.b1_A022 Drought-stresse... 44 0.007
gb|CF665710.1|CF665710 RTCNT1_18_A07.b1_A029 Root control P... 44 0.007
gb|CO159491.1|CO159491 FLD1_14_A02.b1_A029 Root flooded Pin... 44 0.007
gb|CO162594.1|CO162594 FLD1_36_G06.b1_A029 Root flooded Pin... 44 0.007
gb|CO169069.1|CO169069 NDL1_4_B04.g1_A029 Needles control P... 44 0.007
gb|CO370232.1|CO370232 RTK1_66_B04.g1_A029 Roots minus pota... 44 0.007
gb|DR015187.1|DR015187 STRS1_2_B02.b1_A034 Shoot tip pitch ... 44 0.007
gb|DR015267.1|DR015267 STRS1_2_B02.g1_A034 Shoot tip pitch ... 44 0.007
gb|DR080765.1|DR080765 RTFEPL1_25_C06.b1_A029 Roots plus ad... 44 0.007
gb|DR080835.1|DR080835 RTFEPL1_25_C06.g1_A029 Roots plus ad... 44 0.007
gb|DR081229.1|DR081229 RTFEPL1_28_F08.b1_A029 Roots plus ad... 44 0.007
gb|DR081312.1|DR081312 RTFEPL1_28_F08.g1_A029 Roots plus ad... 44 0.007
gb|DR116993.1|DR116993 RTMG1_4_C06.b1_A029 Roots minus magn... 44 0.007
gb|DR387087.1|DR387087 RTHG1_19_G09.b1_A029 Roots plus adde... 44 0.007
gb|DR387158.1|DR387158 RTHG1_19_G09.g1_A029 Roots plus adde... 44 0.007
gb|DR681963.1|DR681963 EST1072038 Normalized pine embryo li... 44 0.007
gb|DT630885.1|DT630885 EST1145816 Normalized pine embryo li... 44 0.007
gb|CF474681.1|CF474681 RTWW2_7_G05.b1_A021 Well-watered lob... 38 0.46
gb|CF474764.1|CF474764 RTWW2_7_G05.g1_A021 Well-watered lob... 38 0.46
gb|CO159024.1|CO159024 FLD1_10_G04.g1_A029 Root flooded Pin... 38 0.46
gb|CO159572.1|CO159572 FLD1_14_A02.g1_A029 Root flooded Pin... 38 0.46
gb|CV034690.1|CV034690 RTNACL1_11_A01.b1_A029 Roots plus ad... 38 0.46
gb|BM492311.1|BM492311 NXRV_024_E04_F NXRV (Nsf Xylem Root ... 36 1.8
gb|BQ654599.1|BQ654599 NXRV082_G05_F NXRV (Nsf Xylem Root w... 36 1.8
gb|BQ698105.1|BQ698105 NXPV_064_F02_F NXPV (Nsf Xylem Plani... 36 1.8
gb|BQ702060.1|BQ702060 NXSI_123_H06_F NXSI (Nsf Xylem Side ... 36 1.8
gb|CD028509.1|CD028509 NXSI_119_G09_F NXSI (Nsf Xylem Side ... 36 1.8
gb|CF387261.1|CF387261 RTDR1_11_C04.g1_A015 Loblolly pine r... 36 1.8
gb|CF392372.1|CF392372 RTDR3_7_A09.g1_A022 Loblolly pine ro... 36 1.8
gb|CF394365.1|CF394365 RTDS2_5_G11.b1_A021 Drought-stressed... 36 1.8
gb|CF394460.1|CF394460 RTDS2_5_G11.g1_A021 Drought-stressed... 36 1.8
gb|CF477758.1|CF477758 RTWW3_9_G04.g1_A022 Well-watered lob... 36 1.8
gb|CF664369.1|CF664369 RTCNT1_9_H03.b1_A029 Root control Pi... 36 1.8
gb|CO166093.1|CO166093 FLD1_59_F07.b1_A029 Root flooded Pin... 36 1.8
gb|CO197984.1|CO197984 GEO1_10_B05.g1_A029 Root gravitropis... 36 1.8
gb|CO367726.1|CO367726 RTK1_36_D04.b1_A029 Roots minus pota... 36 1.8
gb|CV036211.1|CV036211 RTNACL1_57_B06.g1_A029 Roots plus ad... 36 1.8
gb|CX648980.1|CX648980 COLD1_32_D12.b1_A029 Root cold Pinus... 36 1.8
gb|CX649055.1|CX649055 COLD1_32_D12.g1_A029 Root cold Pinus... 36 1.8
gb|CX650080.1|CX650080 COLD1_43_H08.b1_A029 Root cold Pinus... 36 1.8
gb|DR015881.1|DR015881 STRS1_6_F09.b1_A034 Shoot tip pitch ... 36 1.8
gb|DR017816.1|DR017816 STRS1_18_E02.g1_A034 Shoot tip pitch... 36 1.8
gb|DR021149.1|DR021149 STRS1_42_D09.g1_A034 Shoot tip pitch... 36 1.8
gb|DR021979.1|DR021979 STRS1_48_C10.b1_A034 Shoot tip pitch... 36 1.8
gb|DR050084.1|DR050084 RTBOR1_21_E03.b1_A029 Roots plus add... 36 1.8
gb|DR053248.1|DR053248 RTCA1_9_H08.g1_A029 Roots minus calc... 36 1.8
gb|DR058589.1|DR058589 RTNIT1_12_F01.g1_A029 Roots minus ni... 36 1.8
gb|DR079108.1|DR079108 RTFEPL1_9_D04.b1_A029 Roots plus add... 36 1.8
gb|DR079180.1|DR079180 RTFEPL1_9_D04.g1_A029 Roots plus add... 36 1.8
gb|DR092996.1|DR092996 STRR1_5_H09.b1_A033 Stem Response Re... 36 1.8
gb|DR093081.1|DR093081 STRR1_5_H09.g1_A033 Stem Response Re... 36 1.8
gb|DR101494.1|DR101494 STRR1_73_C07.g1_A033 Stem Response R... 36 1.8
gb|DR111247.1|DR111247 RTS1_16_H12.b1_A029 Roots minus sulf... 36 1.8
gb|DR111325.1|DR111325 RTS1_16_H12.g1_A029 Roots minus sulf... 36 1.8
gb|DR120126.1|DR120126 RTMG1_27_E03.g2_A029 Roots minus mag... 36 1.8
gb|DR168694.1|DR168694 RTPHOS1_27_F01.b1_A029 Roots minus p... 36 1.8
gb|DR386373.1|DR386373 RTHG1_14_E11.g1_A029 Roots plus adde... 36 1.8
gb|DR687593.1|DR687593 EST1077675 Normalized pine embryo li... 36 1.8
gb|DR693081.1|DR693081 EST1083169 Normalized pine embryo li... 36 1.8
gb|DT634041.1|DT634041 EST1148972 Normalized pine embryo li... 36 1.8
gb|DT636778.1|DT636778 EST1151709 Normalized pine embryo li... 36 1.8
gb|BX251663.1|BX251663 BX251663 Pinus pinaster differenciat... 34 7.1
gb|BG039404.1|BG039404 NXSI_098_F09_F NXSI (Nsf Xylem Side ... 34 7.1
gb|BM367474.1|BM367474 NXLV_049_G03_F NXLV (Nsf Xylem Late ... 34 7.1
gb|CF385433.1|CF385433 RTDR1_3_F12.g1_A015 Loblolly pine ro... 34 7.1
gb|CO159113.1|CO159113 FLD1_11_A07.g1_A029 Root flooded Pin... 34 7.1
gb|CO163046.1|CO163046 FLD1_39_D02.b1_A029 Root flooded Pin... 34 7.1
gb|CO163104.1|CO163104 FLD1_39_B03.g1_A029 Root flooded Pin... 34 7.1
gb|CO164842.1|CO164842 FLD1_50_D11.g1_A029 Root flooded Pin... 34 7.1
gb|CO167636.1|CO167636 FLD1_70_E04.b1_A029 Root flooded Pin... 34 7.1
gb|CO167711.1|CO167711 FLD1_70_E04.g1_A029 Root flooded Pin... 34 7.1
gb|CO167744.1|CO167744 FLD1_70_H05.g1_A029 Root flooded Pin... 34 7.1
gb|CO200254.1|CO200254 GEO2_6_G09.b1_A032 Root gravitropism... 34 7.1
gb|CV033254.1|CV033254 RTNACL1_33_G10.b1_A029 Roots plus ad... 34 7.1
gb|CV135490.1|CV135490 EST846699 Sequencing ESTs from loblo... 34 7.1
gb|CV138422.1|CV138422 EST849631 Sequencing ESTs from loblo... 34 7.1
gb|CX645999.1|CX645999 COLD1_6_D07.g1_A029 Root cold Pinus ... 34 7.1
gb|CX715970.1|CX715970 RTPQ1_39_B09.b1_A032 Roots treated w... 34 7.1
gb|DN462581.1|DN462581 EST958380 Sequencing ESTs from loblo... 34 7.1
gb|DR095327.1|DR095327 STRR1_20_G06.b1_A033 Stem Response R... 34 7.1
gb|DR095408.1|DR095408 STRR1_20_G06.g1_A033 Stem Response R... 34 7.1
gb|DR101717.1|DR101717 STRR1_75_F12.b1_A033 Stem Response R... 34 7.1
gb|DR120086.1|DR120086 RTMG1_27_A08.g2_A029 Roots minus mag... 34 7.1
gb|DR742337.1|DR742337 RTCU1_3_H01.b1_A029 Roots plus added... 34 7.1
gb|DR746367.1|DR746367 RTCU1_36_B08.g1_A029 Roots plus adde... 34 7.1
gb|DT624688.1|DT624688 EST1159023 Sequencing ESTs from lobl... 34 7.1
>gb|CF670782.1|CF670782 RTCNT1_52_B12.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_52_B12_A029 5', mRNA sequence
Length = 690
Score = 63.9 bits (32), Expect = 8e-009
Identities = 74/88 (84%)
Strand = Plus / Minus
Query: 445 cagaacatcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgcc 504
|||||| || || ||||| ||||| || | ||| ||||||||||| ||||||||||||||
Sbjct: 150 cagaacttcctcccctcctgggtgttcttgcaggaacttggtcacgttgtacaccttgcc 91
Query: 505 gccgatgacgagccagcagtcgtccttg 532
|||||||| | |||||| || ||||||
Sbjct: 90 accgatgacaaaccagcaatcctccttg 63
>gb|CX645400.1|CX645400 COLD1_2_B07.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_2_B07_A029 5', mRNA sequence
Length = 752
Score = 63.9 bits (32), Expect = 8e-009
Identities = 74/88 (84%)
Strand = Plus / Minus
Query: 445 cagaacatcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgcc 504
|||||| || || ||||| ||||| || | ||| ||||||||||| ||||||||||||||
Sbjct: 110 cagaacttcctcccctcctgggtgttcttgcaggaacttggtcacgttgtacaccttgcc 51
Query: 505 gccgatgacgagccagcagtcgtccttg 532
|||||||| | |||||| || ||||||
Sbjct: 50 accgatgacaaaccagcaatcctccttg 23
>gb|DR054781.1|DR054781 RTCA1_19_C01.g1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_19_C01_A029 5', mRNA sequence
Length = 724
Score = 63.9 bits (32), Expect = 8e-009
Identities = 74/88 (84%)
Strand = Plus / Minus
Query: 445 cagaacatcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgcc 504
|||||| || || ||||| ||||| || | ||| ||||||||||| ||||||||||||||
Sbjct: 200 cagaacttcctcccctcctgggtgttcttgcaggaacttggtcacgttgtacaccttgcc 141
Query: 505 gccgatgacgagccagcagtcgtccttg 532
|||||||| | |||||| || ||||||
Sbjct: 140 accgatgacaaaccagcaatcctccttg 113
>gb|CV036580.1|CV036580 RTNACL1_60_F04.b1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_60_F04_A029 3', mRNA sequence
Length = 860
Score = 61.9 bits (31), Expect = 3e-008
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| |||||||| | |||||| || ||||||
Sbjct: 78 aacttggtcacgttgtacaccttgccaccgatgacnaaccagcaatcctccttg 25
>gb|DR020199.1|DR020199 STRS1_35_G03.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_35_G03_A034 3', mRNA sequence
Length = 720
Score = 61.9 bits (31), Expect = 3e-008
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 458 cctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatgacgagc 517
||||| ||||| || | ||| ||||||||||| |||||||||||||| |||||||| | |
Sbjct: 520 cctcctgggtgttcttgcaggaacttggtcacgttgtacaccttgccaccgatgacaaac 579
Query: 518 cagcagtcgtccttg 532
||||| || ||||||
Sbjct: 580 cagcaatcctccttg 594
>gb|DR094669.1|DR094669 STRR1_16_B04.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_16_B04_A033 3', mRNA sequence
Length = 669
Score = 61.9 bits (31), Expect = 3e-008
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 458 cctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatgacgagc 517
||||| ||||| || | ||| ||||||||||| |||||||||||||| |||||||| | |
Sbjct: 461 cctcctgggtgttcttgcaggaacttggtcacgttgtacaccttgccaccgatgacaaac 520
Query: 518 cagcagtcgtccttg 532
||||| || ||||||
Sbjct: 521 cagcaatcctccttg 535
>gb|DR094743.1|DR094743 STRR1_16_B04.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_16_B04_A033 5', mRNA sequence
Length = 661
Score = 61.9 bits (31), Expect = 3e-008
Identities = 64/75 (85%)
Strand = Plus / Plus
Query: 458 cctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatgacgagc 517
||||| ||||| || | ||| ||||||||||| |||||||||||||| |||||||| | |
Sbjct: 447 cctcctgggtgttcttgcaggaacttggtcacgttgtacaccttgccaccgatgacaaac 506
Query: 518 cagcagtcgtccttg 532
||||| || ||||||
Sbjct: 507 cagcaatcctccttg 521
>gb|CF474235.1|CF474235 RTWW2_17_A03.g1_A021 Well-watered loblolly pine roots WW2 Pinus
taeda cDNA clone RTWW2_17_A03_A021 5', mRNA sequence
Length = 731
Score = 60.0 bits (30), Expect = 1e-007
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| |||||||| | |||||| || ||||||
Sbjct: 156 aacttggtcacgttgtacaccttgccaccgatgacaaaccagcaatcctccttg 103
>gb|CF671366.1|CF671366 RTCNT1_56_D01.g1_A029 Root control Pinus taeda cDNA clone
RTCNT1_56_D01_A029 5', mRNA sequence
Length = 562
Score = 60.0 bits (30), Expect = 1e-007
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| |||||||| | |||||| || ||||||
Sbjct: 82 aacttggtcacgttgtacaccttgccaccgatgacaaaccagcaatcctccttg 29
>gb|CO366873.1|CO366873 RTK1_30_E06.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_30_E06_A029 5', mRNA sequence
Length = 736
Score = 60.0 bits (30), Expect = 1e-007
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| |||||||| | |||||| || ||||||
Sbjct: 156 aacttggtcacgttgtacaccttgccaccgatgacaaaccagcaatcctccttg 103
>gb|CV036477.1|CV036477 RTNACL1_59_B12.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_59_B12_A029 5', mRNA sequence
Length = 786
Score = 60.0 bits (30), Expect = 1e-007
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| |||||||| | |||||| || ||||||
Sbjct: 156 aacttggtcacgttgtacaccttgccaccgatgacaaaccagcaatcctccttg 103
>gb|CV036651.1|CV036651 RTNACL1_60_F04.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_60_F04_A029 5', mRNA sequence
Length = 721
Score = 60.0 bits (30), Expect = 1e-007
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| |||||||| | |||||| || ||||||
Sbjct: 156 aacttggtcacgttgtacaccttgccaccgatgacaaaccagcaatcctccttg 103
>gb|CX649684.1|CX649684 COLD1_36_G06.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_36_G06_A029 5', mRNA sequence
Length = 434
Score = 60.0 bits (30), Expect = 1e-007
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| |||||||| | |||||| || ||||||
Sbjct: 139 aacttggtcacgttgtacaccttgccaccgatgacaaaccagcaatcctccttg 86
>gb|DR011689.1|DR011689 HEAT1_7_F11.b1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_7_F11_A029 3', mRNA sequence
Length = 645
Score = 60.0 bits (30), Expect = 1e-007
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| |||||||| | |||||| || ||||||
Sbjct: 173 aacttggtcacgttgtacaccttgccaccgatgacaaaccagcaatcctccttg 120
>gb|DR011768.1|DR011768 HEAT1_7_F11.g1_A029 Root at 37 C for 24 hr Pinus taeda cDNA clone
HEAT1_7_F11_A029 5', mRNA sequence
Length = 615
Score = 60.0 bits (30), Expect = 1e-007
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| |||||||| | |||||| || ||||||
Sbjct: 143 aacttggtcacgttgtacaccttgccaccgatgacaaaccagcaatcctccttg 90
>gb|DR019319.1|DR019319 STRS1_29_E04.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_29_E04_A034 3', mRNA sequence
Length = 892
Score = 60.0 bits (30), Expect = 1e-007
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| |||||||| | |||||| || ||||||
Sbjct: 717 aacttggtcacgttgtacaccttgccaccgatgacaaaccagcaatcctccttg 770
>gb|DR059746.1|DR059746 RTNIT1_19_C01.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_19_C01_A029 5', mRNA sequence
Length = 660
Score = 60.0 bits (30), Expect = 1e-007
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| |||||||| | |||||| || ||||||
Sbjct: 140 aacttggtcacgttgtacaccttgccaccgatgacaaaccagcaatcctccttg 87
>gb|DR089772.1|DR089772 RTAL1_10_E10.g1_A029 Roots plus added aluminum Pinus taeda cDNA
clone RTAL1_10_E10_A029 5', mRNA sequence
Length = 607
Score = 60.0 bits (30), Expect = 1e-007
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| |||||||| | |||||| || ||||||
Sbjct: 184 aacttggtcacgttgtacaccttgccaccgatgacaaaccagcaatcctccttg 131
>gb|DR119693.1|DR119693 RTMG1_24_G10.g1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_24_G10_A029 5', mRNA sequence
Length = 683
Score = 60.0 bits (30), Expect = 1e-007
Identities = 48/54 (88%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| |||||||| | |||||| || ||||||
Sbjct: 169 aacttggtcacgttgtacaccttgccaccgatgacaaaccagcaatcctccttg 116
>gb|DR743961.1|DR743961 RTCU1_19_G03.b1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_19_G03_A029 3', mRNA sequence
Length = 789
Score = 60.0 bits (30), Expect = 1e-007
Identities = 48/54 (88%)
Strand = Plus / Plus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| |||||||| | |||||| || ||||||
Sbjct: 613 aacttggtcacgttgtacaccttgccaccgatgacaaaccagcaatcctccttg 666
>gb|DR102773.1|DR102773 STRR1_83_F05.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_83_F05_A033 5', mRNA sequence
Length = 465
Score = 56.0 bits (28), Expect = 2e-006
Identities = 49/56 (87%)
Strand = Plus / Plus
Query: 458 cctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatgac 513
||||| ||||| || | ||| ||||||||||| |||||||||||||| ||||||||
Sbjct: 350 cctcctgggtgttcttgcaggaacttggtcacgttgtacaccttgccaccgatgac 405
>gb|DR098767.1|DR098767 STRR1_47_F01.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_47_F01_A033 5', mRNA sequence
Length = 614
Score = 54.0 bits (27), Expect = 8e-006
Identities = 33/35 (94%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatgac 513
||||||||||| |||||||||||||| ||||||||
Sbjct: 39 aacttggtcacgttgtacaccttgccaccgatgac 5
>gb|BX249163.1|BX249163 BX249163 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP020G02 similar to CYTOCHROME B5, mRNA
sequence
Length = 693
Score = 52.0 bits (26), Expect = 3e-005
Identities = 107/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| |||||||| || ||||| ||| |||| | || | ||| ||
Sbjct: 192 ctgtgcccaacatcttcaaaatcatctgttgcatctttgccagttgctgataacagcact 133
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| ||||| |||| |||||||| || || ||
Sbjct: 132 tcatctcctcctgggtgttcttccaaaaaattggtaacatcatacacctttccaccaata 73
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 72 acaagccagcagtc 59
>gb|BX252786.1|BX252786 BX252786 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP070F12 similar to CYTOCHROME B5, mRNA
sequence
Length = 598
Score = 52.0 bits (26), Expect = 3e-005
Identities = 107/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| |||||||| || ||||| ||| |||| | || | ||| ||
Sbjct: 266 ctgtgcccaacatcttcaaaatcatctgttgcatctttgccagttgctgataacagcact 207
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| ||||| |||| |||||||| || || ||
Sbjct: 206 tcatctcctcctgggtgttcttccaaaaaattggtaacatcatacacctttccaccaata 147
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 146 acaagccagcagtc 133
>gb|CO366800.1|CO366800 RTK1_30_E06.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_30_E06_A029 3', mRNA sequence
Length = 864
Score = 52.0 bits (26), Expect = 3e-005
Identities = 32/34 (94%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatga 512
||||||||||| |||||||||||||| |||||||
Sbjct: 99 aacttggtcacgttgtacaccttgccaccgatga 66
>gb|DR019591.1|DR019591 STRS1_31_C08.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_31_C08_A034 3', mRNA sequence
Length = 838
Score = 52.0 bits (26), Expect = 3e-005
Identities = 47/54 (87%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgccgccgatgacgagccagcagtcgtccttg 532
||||||||||| |||||||||||||| ||||||| | |||||| || ||||||
Sbjct: 63 aacttggtcacgttgtacaccttgcccacgatgacaaaccagcaatcctccttg 10
>gb|AW755006.1|AW755006 PC09E04 Pine TriplEx pollen cone library Pinus taeda cDNA clone
PC09E04, mRNA sequence
Length = 502
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 397 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 338
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 337 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 278
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 277 acaagccagcagtc 264
>gb|BE452000.1|BE452000 NXCI_007_C04_F NXCI (Nsf Xylem Compression wood Inclined) Pinus
taeda cDNA clone NXCI_007_C04 5' similar to Arabidopsis
thaliana sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 575
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 258 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 199
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 198 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 139
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 138 acaagccagcagtc 125
>gb|BF517750.1|BF517750 NXSI_029_G09_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_029_G09 5' similar to Arabidopsis thaliana
sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 501
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 187 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 128
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 127 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 68
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 67 acaagccagcagtc 54
>gb|BF777460.1|BF777460 NXSI_071_H02_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_071_H02 5' similar to Arabidopsis thaliana
sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 443
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 239 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 180
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 179 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 120
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 119 acaagccagcagtc 106
>gb|BF777931.1|BF777931 NXSI_079_A05_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_079_A05 5' similar to Arabidopsis thaliana
sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 413
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 239 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 180
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 179 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 120
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 119 acaagccagcagtc 106
>gb|BF778525.1|BF778525 NXSI_085_G03_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_085_G03 5' similar to Arabidopsis thaliana
sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 472
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 278 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 219
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 218 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 159
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 158 acaagccagcagtc 145
>gb|BG040829.1|BG040829 NXSI_115_F01_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_115_F01 5' similar to Arabidopsis thaliana
sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 325
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 191 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 132
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 131 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 72
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 71 acaagccagcagtc 58
>gb|BG317490.1|BG317490 NXPV_002_D10_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_002_D10 5' similar to Arabidopsis
thaliana sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 408
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 257 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 198
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 197 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 138
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 137 acaagccagcagtc 124
>gb|BI202865.1|BI202865 NXPV_091_E02_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_091_E02 5' similar to Arabidopsis
thaliana sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 515
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 257 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 198
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 197 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 138
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 137 acaagccagcagtc 124
>gb|BM427882.1|BM427882 NXRV_005_F01_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV_005_F01 5' similar to Arabidopsis thaliana
sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 576
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 253 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 194
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 193 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 134
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 133 acaagccagcagtc 120
>gb|BQ291219.1|BQ291219 NXRV057_D08_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV057_D08 5' similar to Arabidopsis thaliana
sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 550
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 381 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgttgataacagcact 322
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 321 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 262
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 261 acaagccagcagtc 248
>gb|BQ634682.1|BQ634682 NXRV072_A03_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV072_A03 5' similar to Arabidopsis thaliana
sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 660
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 297 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 238
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 237 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 178
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 177 acaagccagcagtc 164
>gb|BQ697198.1|BQ697198 NXPV_050_F10_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_050_F10 5' similar to Arabidopsis
thaliana sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 427
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 257 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 198
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 197 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 138
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 137 acaagccagcagtc 124
>gb|BQ697618.1|BQ697618 NXPV_058_G06_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_058_G06 5' similar to Arabidopsis
thaliana sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 395
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 222 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 163
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 162 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 103
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 102 acaagccagcagtc 89
>gb|BQ701178.1|BQ701178 NXSI_023_E02_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_023_E02 5' similar to Arabidopsis thaliana
sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 494
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 239 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 180
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 179 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 120
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 119 acaagccagcagtc 106
>gb|CD028507.1|CD028507 NXSI_119_G07_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_119_G07 5' similar to Arabidopsis thaliana
sequence At2g32720 putative cytochrome b5 see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 540
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 217 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 158
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 157 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 98
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 97 acaagccagcagtc 84
>gb|CF399489.1|CF399489 RTDS3_26_F04.b1_A022 Drought-stressed loblolly pine roots DS3 Pinus
taeda cDNA clone RTDS3_26_F04_A022 3', mRNA sequence
Length = 525
Score = 44.1 bits (22), Expect = 0.007
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 479 aacttggtcacattgtacaccttgcc 504
||||||||||| ||||||||||||||
Sbjct: 27 aacttggtcacgttgtacaccttgcc 2
>gb|CF665710.1|CF665710 RTCNT1_18_A07.b1_A029 Root control Pinus taeda cDNA clone
RTCNT1_18_A07_A029 3', mRNA sequence
Length = 765
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Plus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 295 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 354
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 355 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 414
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 415 acaagccagcagtc 428
>gb|CO159491.1|CO159491 FLD1_14_A02.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_14_A02_A029 3', mRNA sequence
Length = 668
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Plus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 145 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 204
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 205 tcatctcctcctgggtgttcttccaaaaaatgggtaacatcatacacctttccaccaatg 264
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 265 acaagccagcagtc 278
>gb|CO162594.1|CO162594 FLD1_36_G06.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_36_G06_A029 3', mRNA sequence
Length = 615
Score = 44.1 bits (22), Expect = 0.007
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 526 gtccttggtgttgtgcttggccacctcctc 555
||||||||||||||||||||| | ||||||
Sbjct: 218 gtccttggtgttgtgcttggcgatctcctc 189
>gb|CO169069.1|CO169069 NDL1_4_B04.g1_A029 Needles control Pinus taeda cDNA clone
NDL1_4_B04_A029 5', mRNA sequence
Length = 680
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 334 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 275
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 274 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 215
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 214 acaagccagcagtc 201
>gb|CO370232.1|CO370232 RTK1_66_B04.g1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_66_B04_A029 5', mRNA sequence
Length = 640
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 345 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 286
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 285 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 226
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 225 acaagccagcagtc 212
>gb|DR015187.1|DR015187 STRS1_2_B02.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_2_B02_A034 3', mRNA sequence
Length = 783
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 276 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 217
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 216 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 157
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 156 acaagccagcagtc 143
>gb|DR015267.1|DR015267 STRS1_2_B02.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_2_B02_A034 5', mRNA sequence
Length = 763
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 251 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 192
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 191 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 132
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 131 acaagccagcagtc 118
>gb|DR080765.1|DR080765 RTFEPL1_25_C06.b1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_25_C06_A029 3', mRNA sequence
Length = 768
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 242 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 183
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 182 tcatctcctcctgggtgttcttccaaaaaatgggtaacatcatacacctttccaccaatg 123
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 122 acaagccagcagtc 109
>gb|DR080835.1|DR080835 RTFEPL1_25_C06.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_25_C06_A029 5', mRNA sequence
Length = 652
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 330 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 271
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 270 tcatctcctcctgggtgttcttccaaaaaatgggtaacatcatacacctttccaccaatg 211
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 210 acaagccagcagtc 197
>gb|DR081229.1|DR081229 RTFEPL1_28_F08.b1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_28_F08_A029 3', mRNA sequence
Length = 667
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 141 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 82
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 81 tcatctcctcctgggtgttcttccaaaaaatgggtaacatcatacacctttccaccaatg 22
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 21 acaagccagcagtc 8
>gb|DR081312.1|DR081312 RTFEPL1_28_F08.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_28_F08_A029 5', mRNA sequence
Length = 468
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 322 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 263
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 262 tcatctcctcctgggtgttcttccaaaaaatgggtaacatcatacacctttccaccaatg 203
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 202 acaagccagcagtc 189
>gb|DR116993.1|DR116993 RTMG1_4_C06.b1_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_4_C06_A029 3', mRNA sequence
Length = 867
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Plus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 505 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 564
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 565 tcatctcctcctgggtgttcttccaaaaaatgggtaacatcatacacctttccaccaatg 624
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 625 acaagccagcagtc 638
>gb|DR387087.1|DR387087 RTHG1_19_G09.b1_A029 Roots plus added mercury Pinus taeda cDNA
clone RTHG1_19_G09_A029 3', mRNA sequence
Length = 646
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 151 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 92
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 91 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 32
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 31 acaagccagcagtc 18
>gb|DR387158.1|DR387158 RTHG1_19_G09.g1_A029 Roots plus added mercury Pinus taeda cDNA
clone RTHG1_19_G09_A029 5', mRNA sequence
Length = 738
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 245 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 186
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 185 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 126
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 125 acaagccagcagtc 112
>gb|DR681963.1|DR681963 EST1072038 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWAA452, mRNA sequence
Length = 853
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Plus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 541 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 600
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 601 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 660
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 661 acaagccagcagtc 674
>gb|DT630885.1|DT630885 EST1145816 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMF189 3' end, mRNA sequence
Length = 741
Score = 44.1 bits (22), Expect = 0.007
Identities = 106/134 (79%)
Strand = Plus / Minus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 400 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 341
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 340 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 281
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 280 acaagccagcagtc 267
>gb|CF474681.1|CF474681 RTWW2_7_G05.b1_A021 Well-watered loblolly pine roots WW2 Pinus
taeda cDNA clone RTWW2_7_G05_A021 3', mRNA sequence
Length = 556
Score = 38.2 bits (19), Expect = 0.46
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 510 tgacgagccagcagtcgtccttg 532
||||||||||||||||| |||||
Sbjct: 65 tgacgagccagcagtcgaccttg 43
>gb|CF474764.1|CF474764 RTWW2_7_G05.g1_A021 Well-watered loblolly pine roots WW2 Pinus
taeda cDNA clone RTWW2_7_G05_A021 5', mRNA sequence
Length = 704
Score = 38.2 bits (19), Expect = 0.46
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 510 tgacgagccagcagtcgtccttg 532
||||||||||||||||| |||||
Sbjct: 526 tgacgagccagcagtcgaccttg 504
>gb|CO159024.1|CO159024 FLD1_10_G04.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_10_G04_A029 5', mRNA sequence
Length = 704
Score = 38.2 bits (19), Expect = 0.46
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggcg 627
|||||||||||||||||||
Sbjct: 416 ggtggaggaggcggaggcg 398
>gb|CO159572.1|CO159572 FLD1_14_A02.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_14_A02_A029 5', mRNA sequence
Length = 694
Score = 38.2 bits (19), Expect = 0.46
Identities = 105/134 (78%)
Strand = Plus / Plus
Query: 392 ctgtgccccacatcttcgaaatcatcggtagcatccttggcagtggaagacagcagaaca 451
|||||||| |||||||| ||||| || || ||||| ||| |||| | || | ||| ||
Sbjct: 527 ctgtgcccaacatcttcaaaatcgtctgttgcatctttgccagttgctgataacagcact 586
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| | ||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 587 tcatctcctcctgngtgttcttccaaaaaatgggtaacatcatacacctttccaccaatg 646
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 647 acaagccagcagtc 660
>gb|CV034690.1|CV034690 RTNACL1_11_A01.b1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_11_A01_A029 3', mRNA sequence
Length = 706
Score = 38.2 bits (19), Expect = 0.46
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 410 aaatcatcggtagcatcct 428
|||||||||||||||||||
Sbjct: 334 aaatcatcggtagcatcct 316
>gb|BM492311.1|BM492311 NXRV_024_E04_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV_024_E04 5' similar to Arabidopsis thaliana
sequence At2g47790 unknown protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 404
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 588 tcttcctctgttgacggt 605
||||||||||||||||||
Sbjct: 339 tcttcctctgttgacggt 356
>gb|BQ654599.1|BQ654599 NXRV082_G05_F NXRV (Nsf Xylem Root wood Vertical) Pinus taeda cDNA
clone NXRV082_G05 5' similar to Arabidopsis thaliana
sequence At2g47790 unknown protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 627
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 588 tcttcctctgttgacggt 605
||||||||||||||||||
Sbjct: 339 tcttcctctgttgacggt 356
>gb|BQ698105.1|BQ698105 NXPV_064_F02_F NXPV (Nsf Xylem Planings wood Vertical) Pinus taeda
cDNA clone NXPV_064_F02 5' similar to Arabidopsis
thaliana sequence At4g18590 pollen-specific protein -
like see http://mips.gsf.de/proj/thal/db/index.html,
mRNA sequence
Length = 519
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 22 gaaggaaaaatagaagtg 39
||||||||||||||||||
Sbjct: 330 gaaggaaaaatagaagtg 347
>gb|BQ702060.1|BQ702060 NXSI_123_H06_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_123_H06 5', mRNA sequence
Length = 428
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 307 ggtggaggaggcggaggc 290
>gb|CD028509.1|CD028509 NXSI_119_G09_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_119_G09 5', mRNA sequence
Length = 406
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 321 ggtggaggaggcggaggc 304
>gb|CF387261.1|CF387261 RTDR1_11_C04.g1_A015 Loblolly pine roots recovering from drought
DR1 Pinus taeda cDNA clone RTDR1_11_C04_A015 5', mRNA
sequence
Length = 796
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 313 ggtggaggaggcggaggc 296
>gb|CF392372.1|CF392372 RTDR3_7_A09.g1_A022 Loblolly pine roots recovering from drought DR3
Pinus taeda cDNA clone RTDR3_7_A09_A022 5', mRNA
sequence
Length = 563
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 284 ggtggaggaggcggaggc 267
>gb|CF394365.1|CF394365 RTDS2_5_G11.b1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_5_G11_A021 3', mRNA sequence
Length = 660
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 639 ctgcaagctgttgctgct 656
||||||||||||||||||
Sbjct: 61 ctgcaagctgttgctgct 44
>gb|CF394460.1|CF394460 RTDS2_5_G11.g1_A021 Drought-stressed loblolly pine roots DS2 Pinus
taeda cDNA clone RTDS2_5_G11_A021 5', mRNA sequence
Length = 754
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 639 ctgcaagctgttgctgct 656
||||||||||||||||||
Sbjct: 538 ctgcaagctgttgctgct 521
>gb|CF477758.1|CF477758 RTWW3_9_G04.g1_A022 Well-watered loblolly pine roots WW3 Pinus
taeda cDNA clone RTWW3_9_G04_A022 5', mRNA sequence
Length = 713
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 173 ggtggaggaggcggaggc 156
>gb|CF664369.1|CF664369 RTCNT1_9_H03.b1_A029 Root control Pinus taeda cDNA clone
RTCNT1_9_H03_A029 3', mRNA sequence
Length = 687
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 22 gaaggaaaaatagaagtg 39
||||||||||||||||||
Sbjct: 161 gaaggaaaaatagaagtg 178
>gb|CO166093.1|CO166093 FLD1_59_F07.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_59_F07_A029 3', mRNA sequence
Length = 631
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 22 gaaggaaaaatagaagtg 39
||||||||||||||||||
Sbjct: 52 gaaggaaaaatagaagtg 69
>gb|CO197984.1|CO197984 GEO1_10_B05.g1_A029 Root gravitropism April 2003 test Pinus taeda
cDNA clone GEO1_10_B05_A029 5', mRNA sequence
Length = 716
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 639 ctgcaagctgttgctgct 656
||||||||||||||||||
Sbjct: 257 ctgcaagctgttgctgct 240
>gb|CO367726.1|CO367726 RTK1_36_D04.b1_A029 Roots minus potassium Pinus taeda cDNA clone
RTK1_36_D04_A029 3', mRNA sequence
Length = 712
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 639 ctgcaagctgttgctgct 656
||||||||||||||||||
Sbjct: 60 ctgcaagctgttgctgct 43
>gb|CV036211.1|CV036211 RTNACL1_57_B06.g1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_57_B06_A029 5', mRNA sequence
Length = 487
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 22 gaaggaaaaatagaagtg 39
||||||||||||||||||
Sbjct: 404 gaaggaaaaatagaagtg 421
>gb|CX648980.1|CX648980 COLD1_32_D12.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_32_D12_A029 3', mRNA sequence
Length = 758
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 639 ctgcaagctgttgctgct 656
||||||||||||||||||
Sbjct: 160 ctgcaagctgttgctgct 143
>gb|CX649055.1|CX649055 COLD1_32_D12.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_32_D12_A029 5', mRNA sequence
Length = 738
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 639 ctgcaagctgttgctgct 656
||||||||||||||||||
Sbjct: 143 ctgcaagctgttgctgct 126
>gb|CX650080.1|CX650080 COLD1_43_H08.b1_A029 Root cold Pinus taeda cDNA clone
COLD1_43_H08_A029 3', mRNA sequence
Length = 680
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 76 ggtggaggaggcggaggc 59
>gb|DR015881.1|DR015881 STRS1_6_F09.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_6_F09_A034 3', mRNA sequence
Length = 895
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 639 ctgcaagctgttgctgct 656
||||||||||||||||||
Sbjct: 531 ctgcaagctgttgctgct 548
>gb|DR017816.1|DR017816 STRS1_18_E02.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_18_E02_A034 5', mRNA sequence
Length = 685
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 260 ggtggaggaggcggaggc 243
>gb|DR021149.1|DR021149 STRS1_42_D09.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_42_D09_A034 5', mRNA sequence
Length = 548
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 251 ggtggaggaggcggaggc 234
>gb|DR021979.1|DR021979 STRS1_48_C10.b1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_48_C10_A034 3', mRNA sequence
Length = 788
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 22 gaaggaaaaatagaagtg 39
||||||||||||||||||
Sbjct: 255 gaaggaaaaatagaagtg 272
>gb|DR050084.1|DR050084 RTBOR1_21_E03.b1_A029 Roots plus added boron Pinus taeda cDNA clone
RTBOR1_21_E03_A029 3', mRNA sequence
Length = 427
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 588 tcttcctctgttgacggt 605
||||||||||||||||||
Sbjct: 141 tcttcctctgttgacggt 124
>gb|DR053248.1|DR053248 RTCA1_9_H08.g1_A029 Roots minus calcium Pinus taeda cDNA clone
RTCA1_9_H08_A029 5', mRNA sequence
Length = 559
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 297 ggtggaggaggcggaggc 280
>gb|DR058589.1|DR058589 RTNIT1_12_F01.g1_A029 Roots minus nitrogen Pinus taeda cDNA clone
RTNIT1_12_F01_A029 5', mRNA sequence
Length = 687
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 542 ttggccacctcctcgagg 559
||||||||||||||||||
Sbjct: 210 ttggccacctcctcgagg 193
>gb|DR079108.1|DR079108 RTFEPL1_9_D04.b1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_9_D04_A029 3', mRNA sequence
Length = 855
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 482 ggtggaggaggcggaggc 499
>gb|DR079180.1|DR079180 RTFEPL1_9_D04.g1_A029 Roots plus added iron Pinus taeda cDNA clone
RTFEPL1_9_D04_A029 5', mRNA sequence
Length = 812
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 605 ggtggaggaggcggaggc 622
>gb|DR092996.1|DR092996 STRR1_5_H09.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_5_H09_A033 3', mRNA sequence
Length = 864
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 246 ggtggaggaggcggaggc 229
>gb|DR093081.1|DR093081 STRR1_5_H09.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_5_H09_A033 5', mRNA sequence
Length = 854
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 271 ggtggaggaggcggaggc 254
>gb|DR101494.1|DR101494 STRR1_73_C07.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_73_C07_A033 5', mRNA sequence
Length = 416
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 255 ggtggaggaggcggaggc 238
>gb|DR111247.1|DR111247 RTS1_16_H12.b1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_16_H12_A029 3', mRNA sequence
Length = 650
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 20 ggtggaggaggcggaggc 3
>gb|DR111325.1|DR111325 RTS1_16_H12.g1_A029 Roots minus sulfur Pinus taeda cDNA clone
RTS1_16_H12_A029 5', mRNA sequence
Length = 671
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 345 ggtggaggaggcggaggc 328
>gb|DR120126.1|DR120126 RTMG1_27_E03.g2_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_27_E03_A029 5', mRNA sequence
Length = 634
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 285 ggtggaggaggcggaggc 268
>gb|DR168694.1|DR168694 RTPHOS1_27_F01.b1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_27_F01_A029 3', mRNA sequence
Length = 741
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 639 ctgcaagctgttgctgct 656
||||||||||||||||||
Sbjct: 505 ctgcaagctgttgctgct 522
>gb|DR386373.1|DR386373 RTHG1_14_E11.g1_A029 Roots plus added mercury Pinus taeda cDNA
clone RTHG1_14_E11_A029 5', mRNA sequence
Length = 786
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggaggc 626
||||||||||||||||||
Sbjct: 162 ggtggaggaggcggaggc 145
>gb|DR687593.1|DR687593 EST1077675 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWABU31 3' end, mRNA sequence
Length = 741
Score = 36.2 bits (18), Expect = 1.8
Identities = 60/74 (81%)
Strand = Plus / Minus
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 338 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 279
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 278 acaagccagcagtc 265
>gb|DR693081.1|DR693081 EST1083169 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PWADU26 3' end, mRNA sequence
Length = 560
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 588 tcttcctctgttgacggt 605
||||||||||||||||||
Sbjct: 511 tcttcctctgttgacggt 528
>gb|DT634041.1|DT634041 EST1148972 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMG160 3' end, mRNA sequence
Length = 750
Score = 36.2 bits (18), Expect = 1.8
Identities = 60/74 (81%)
Strand = Plus / Minus
Query: 452 tcatcgcctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatg 511
||||| ||||| ||||| || |||| ||| | ||| |||| |||||||| || || |||
Sbjct: 346 tcatctcctcctgggtgttcttccaaaaattgggtaacatcatacacctttccaccaatg 287
Query: 512 acgagccagcagtc 525
|| |||||||||||
Sbjct: 286 acaagccagcagtc 273
>gb|DT636778.1|DT636778 EST1151709 Normalized pine embryo library, Lib_D Pinus taeda cDNA
clone PIMGV67 3' end, mRNA sequence
Length = 838
Score = 36.2 bits (18), Expect = 1.8
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 588 tcttcctctgttgacggt 605
||||||||||||||||||
Sbjct: 38 tcttcctctgttgacggt 55
>gb|BX251663.1|BX251663 BX251663 Pinus pinaster differenciating xylem adult Pinus pinaster
cDNA clone PP053F11, mRNA sequence
Length = 708
Score = 34.2 bits (17), Expect = 7.1
Identities = 53/65 (81%)
Strand = Plus / Minus
Query: 458 cctccagggtgatcctccagaaacttggtcacattgtacaccttgccgccgatgacgagc 517
||||| ||||| || ||||||||||| || |||| || |||||||| || ||||| | |
Sbjct: 409 cctcctgggtgctcttccagaaacttagtaacatcatagaccttgccacctatgacaaac 350
Query: 518 cagca 522
|||||
Sbjct: 349 cagca 345
>gb|BG039404.1|BG039404 NXSI_098_F09_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_098_F09 5', mRNA sequence
Length = 361
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggagg 625
|||||||||||||||||
Sbjct: 175 ggtggaggaggcggagg 159
>gb|BM367474.1|BM367474 NXLV_049_G03_F NXLV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA
clone NXLV_049_G03 5' similar to Arabidopsis thaliana
sequence At1g70600 60S ribosomal protein L27A see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 470
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 612 ggaggaggcggaggcga 628
|||||||||||||||||
Sbjct: 17 ggaggaggcggaggcga 33
>gb|CF385433.1|CF385433 RTDR1_3_F12.g1_A015 Loblolly pine roots recovering from drought DR1
Pinus taeda cDNA clone RTDR1_3_F12_A015 5', mRNA
sequence
Length = 662
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 227 tggaggaggcggaggcg 243
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 125 tggaggaggcggaggcg 141
>gb|CO159113.1|CO159113 FLD1_11_A07.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_11_A07_A029 5', mRNA sequence
Length = 319
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 235 tggaggaggcggaggcg 251
>gb|CO163046.1|CO163046 FLD1_39_D02.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_39_D02_A029 3', mRNA sequence
Length = 627
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 294 tggaggaggcggaggcg 278
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 177 tggaggaggcggaggcg 161
>gb|CO163104.1|CO163104 FLD1_39_B03.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_39_B03_A029 5', mRNA sequence
Length = 469
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 451 tggaggaggcggaggcg 467
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 382 tggaggaggcggaggcg 398
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 265 tggaggaggcggaggcg 281
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 196 tggaggaggcggaggcg 212
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 94 tggaggaggcggaggcg 110
>gb|CO164842.1|CO164842 FLD1_50_D11.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_50_D11_A029 5', mRNA sequence
Length = 683
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 538 tggaggaggcggaggcg 554
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 421 tggaggaggcggaggcg 437
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 352 tggaggaggcggaggcg 368
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 235 tggaggaggcggaggcg 251
>gb|CO167636.1|CO167636 FLD1_70_E04.b1_A029 Root flooded Pinus taeda cDNA clone
FLD1_70_E04_A029 3', mRNA sequence
Length = 698
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 306 tggaggaggcggaggcg 322
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 237 tggaggaggcggaggcg 253
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 132 tggaggaggcggaggcg 148
>gb|CO167711.1|CO167711 FLD1_70_E04.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_70_E04_A029 5', mRNA sequence
Length = 415
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 361 tggaggaggcggaggcg 377
>gb|CO167744.1|CO167744 FLD1_70_H05.g1_A029 Root flooded Pinus taeda cDNA clone
FLD1_70_H05_A029 5', mRNA sequence
Length = 726
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 452 tggaggaggcggaggcg 468
>gb|CO200254.1|CO200254 GEO2_6_G09.b1_A032 Root gravitropism October 2003 test Pinus taeda
cDNA clone GEO2_6_G09_A032 3', mRNA sequence
Length = 819
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 583 cctcgtcttcctctgtt 599
|||||||||||||||||
Sbjct: 397 cctcgtcttcctctgtt 413
>gb|CV033254.1|CV033254 RTNACL1_33_G10.b1_A029 Roots plus added NaCl Pinus taeda cDNA clone
RTNACL1_33_G10_A029 3', mRNA sequence
Length = 682
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 177 tggaggaggcggaggcg 193
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 102 tggaggaggcggaggcg 118
>gb|CV135490.1|CV135490 EST846699 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PICMC55 5' end, mRNA sequence
Length = 246
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 583 cctcgtcttcctctgtt 599
|||||||||||||||||
Sbjct: 229 cctcgtcttcctctgtt 213
>gb|CV138422.1|CV138422 EST849631 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIB293 5' end, mRNA sequence
Length = 718
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 411 tggaggaggcggaggcg 427
>gb|CX645999.1|CX645999 COLD1_6_D07.g1_A029 Root cold Pinus taeda cDNA clone
COLD1_6_D07_A029 5', mRNA sequence
Length = 533
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 583 cctcgtcttcctctgtt 599
|||||||||||||||||
Sbjct: 268 cctcgtcttcctctgtt 252
>gb|CX715970.1|CX715970 RTPQ1_39_B09.b1_A032 Roots treated with paraquat Pinus taeda cDNA
clone RTPQ1_39_B09_A032 3', mRNA sequence
Length = 672
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 583 cctcgtcttcctctgtt 599
|||||||||||||||||
Sbjct: 234 cctcgtcttcctctgtt 250
>gb|DN462581.1|DN462581 EST958380 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone RPIIO16 5' end, mRNA sequence
Length = 913
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggagg 625
|||||||||||||||||
Sbjct: 300 ggtggaggaggcggagg 284
>gb|DR095327.1|DR095327 STRR1_20_G06.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_20_G06_A033 3', mRNA sequence
Length = 867
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 583 cctcgtcttcctctgtt 599
|||||||||||||||||
Sbjct: 439 cctcgtcttcctctgtt 455
>gb|DR095408.1|DR095408 STRR1_20_G06.g1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_20_G06_A033 5', mRNA sequence
Length = 800
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 583 cctcgtcttcctctgtt 599
|||||||||||||||||
Sbjct: 495 cctcgtcttcctctgtt 511
>gb|DR101717.1|DR101717 STRR1_75_F12.b1_A033 Stem Response Resistant Pinus taeda cDNA clone
STRR1_75_F12_A033 3', mRNA sequence
Length = 660
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 583 cctcgtcttcctctgtt 599
|||||||||||||||||
Sbjct: 188 cctcgtcttcctctgtt 204
>gb|DR120086.1|DR120086 RTMG1_27_A08.g2_A029 Roots minus magnesium Pinus taeda cDNA clone
RTMG1_27_A08_A029 5', mRNA sequence
Length = 544
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 529 tggaggaggcggaggcg 513
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 611 tggaggaggcggaggcg 627
|||||||||||||||||
Sbjct: 411 tggaggaggcggaggcg 395
>gb|DR742337.1|DR742337 RTCU1_3_H01.b1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_3_H01_A029 3', mRNA sequence
Length = 449
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 583 cctcgtcttcctctgtt 599
|||||||||||||||||
Sbjct: 245 cctcgtcttcctctgtt 261
>gb|DR746367.1|DR746367 RTCU1_36_B08.g1_A029 Roots plus added copper Pinus taeda cDNA clone
RTCU1_36_B08_A029 5', mRNA sequence
Length = 354
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 79 gactcaagtttcagaat 95
|||||||||||||||||
Sbjct: 216 gactcaagtttcagaat 200
>gb|DT624688.1|DT624688 EST1159023 Sequencing ESTs from loblolly pine embryos Pinus taeda
cDNA clone PIMAI03 5' end, mRNA sequence
Length = 990
Score = 34.2 bits (17), Expect = 7.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 609 ggtggaggaggcggagg 625
|||||||||||||||||
Sbjct: 340 ggtggaggaggcggagg 324
Database: Pinus_nucl_with_EST.fasta
Posted date: May 2, 2006 3:25 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 81,554
Number of Sequences: 355925
Number of extensions: 81554
Number of successful extensions: 23526
Number of sequences better than 10.0: 128
Number of HSP's better than 10.0 without gapping: 127
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 23240
Number of HSP's gapped (non-prelim): 287
length of query: 684
length of database: 217,277,237
effective HSP length: 19
effective length of query: 665
effective length of database: 210,514,662
effective search space: 139992250230
effective search space used: 139992250230
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)