BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 11001390.3.1
(588 letters)
Database: Pinus_nucl_with_EST.fasta
355,925 sequences; 217,277,237 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CZ894987.1|CZ894987 204_1_12063715_3_37680_006 Pine meth... 40 0.099
gb|BF609491.1|BF609491 NXSI_043_C02_F NXSI (Nsf Xylem Side ... 40 0.099
gb|AW981777.1|AW981777 PC18F03 Pine TriplEx pollen cone lib... 36 1.5
gb|AW056768.1|AW056768 ST55F03 Pine TriplEx shoot tip libra... 34 6.1
gb|BM133624.1|BM133624 NXLV_010_A02_F NXLV (Nsf Xylem Late ... 34 6.1
gb|BM367061.1|BM367061 NXLV_044_B06_F NXLV (Nsf Xylem Late ... 34 6.1
gb|CO172433.1|CO172433 NDL1_29_E07.g1_A029 Needles control ... 34 6.1
gb|DR015487.1|DR015487 STRS1_3_G03.g1_A034 Shoot tip pitch ... 34 6.1
gb|DR165924.1|DR165924 RTPHOS1_8_E05.b1_A029 Roots minus ph... 34 6.1
>gb|CZ894987.1|CZ894987 204_1_12063715_3_37680_006 Pine methylation filtered library
(LibID: 204) Pinus taeda genomic, DNA sequence
Length = 794
Score = 40.1 bits (20), Expect = 0.099
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 422 atttttggaaaatcttatagtcta 445
|||||||||||||||||| |||||
Sbjct: 24 atttttggaaaatcttattgtcta 47
>gb|BF609491.1|BF609491 NXSI_043_C02_F NXSI (Nsf Xylem Side wood Inclined) Pinus taeda cDNA
clone NXSI_043_C02 5' similar to Arabidopsis thaliana
sequence At2g28470 beta-galactosidase like protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 318
Score = 40.1 bits (20), Expect = 0.099
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 152 tatgattatgatgcaccaattgacgaatatgg 183
|||||||| ||||||||||| || ||||||||
Sbjct: 236 tatgattacgatgcaccaatagatgaatatgg 267
Score = 38.2 bits (19), Expect = 0.39
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 82 aaattattacatgtattttggtggaac 108
||||||||||||||||| ||| |||||
Sbjct: 169 aaattattacatgtattatggaggaac 195
>gb|AW981777.1|AW981777 PC18F03 Pine TriplEx pollen cone library Pinus taeda cDNA clone
PC18F03, mRNA sequence
Length = 438
Score = 36.2 bits (18), Expect = 1.5
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 460 gagcatactaccagactgtgaa 481
|||||||| |||||||||||||
Sbjct: 391 gagcatacaaccagactgtgaa 370
>gb|AW056768.1|AW056768 ST55F03 Pine TriplEx shoot tip library Pinus taeda cDNA clone
ST55F03, mRNA sequence
Length = 456
Score = 34.2 bits (17), Expect = 6.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 146 actagctatgattatga 162
|||||||||||||||||
Sbjct: 183 actagctatgattatga 167
>gb|BM133624.1|BM133624 NXLV_010_A02_F NXLV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA
clone NXLV_010_A02 5' similar to Arabidopsis thaliana
sequence At4g26670 unknown protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 514
Score = 34.2 bits (17), Expect = 6.1
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 461 agcatactaccagactgtgaa 481
||||||| |||||||||||||
Sbjct: 220 agcatacaaccagactgtgaa 200
>gb|BM367061.1|BM367061 NXLV_044_B06_F NXLV (Nsf Xylem Late wood Vertical) Pinus taeda cDNA
clone NXLV_044_B06 5' similar to Arabidopsis thaliana
sequence At4g26670 unknown protein see
http://mips.gsf.de/proj/thal/db/index.html, mRNA
sequence
Length = 568
Score = 34.2 bits (17), Expect = 6.1
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 461 agcatactaccagactgtgaa 481
||||||| |||||||||||||
Sbjct: 220 agcatacaaccagactgtgaa 200
>gb|CO172433.1|CO172433 NDL1_29_E07.g1_A029 Needles control Pinus taeda cDNA clone
NDL1_29_E07_A029 5', mRNA sequence
Length = 556
Score = 34.2 bits (17), Expect = 6.1
Identities = 20/21 (95%)
Strand = Plus / Minus
Query: 461 agcatactaccagactgtgaa 481
||||||| |||||||||||||
Sbjct: 351 agcatacaaccagactgtgaa 331
>gb|DR015487.1|DR015487 STRS1_3_G03.g1_A034 Shoot tip pitch canker susceptible Pinus taeda
cDNA clone STRS1_3_G03_A034 5', mRNA sequence
Length = 832
Score = 34.2 bits (17), Expect = 6.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 146 actagctatgattatga 162
|||||||||||||||||
Sbjct: 263 actagctatgattatga 247
>gb|DR165924.1|DR165924 RTPHOS1_8_E05.b1_A029 Roots minus phosphorous Pinus taeda cDNA
clone RTPHOS1_8_E05_A029 3', mRNA sequence
Length = 925
Score = 34.2 bits (17), Expect = 6.1
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 489 cttttaatacagccagg 505
|||||||||||||||||
Sbjct: 20 cttttaatacagccagg 4
Database: Pinus_nucl_with_EST.fasta
Posted date: May 2, 2006 3:25 PM
Number of letters in database: 217,277,237
Number of sequences in database: 355,925
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 69,267
Number of Sequences: 355925
Number of extensions: 69267
Number of successful extensions: 18669
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 18658
Number of HSP's gapped (non-prelim): 11
length of query: 588
length of database: 217,277,237
effective HSP length: 19
effective length of query: 569
effective length of database: 210,514,662
effective search space: 119782842678
effective search space used: 119782842678
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)