BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3829406.2.1
(673 letters)
Database: Oryza_nucl_with_EST.fasta
438,736 sequences; 2,800,419,916 total letters
Score E
Sequences producing significant alignments: (bits) Value
ref|XM_472424.1| Oryza sativa (japonica cultivar-group), p... 375 e-101
gb|CA756111.1|CA756111 BR030035000_PLATE_C06_43_040.ab1 OA ... 371 e-100
dbj|AK110485.1| Oryza sativa (japonica cultivar-group) cDNA... 371 e-100
emb|AL606451.1|OSJN00006 Oryza sativa (japonica cultivar-gr... 341 3e-091
gb|AACV01009713.1| Oryza sativa (japonica cultivar-group) c... 341 3e-091
ref|NT_107198.1| Oryza sativa (japonica cultivar-group) 341 3e-091
gb|CH401189.1| Oryza sativa (japonica cultivar-group) chrom... 341 3e-091
gb|CM000141.1| Oryza sativa (japonica cultivar-group) chrom... 341 3e-091
emb|AL606453.2|OSJN00010 Oryza sativa genomic DNA, chromoso... 341 3e-091
dbj|AP008210.1| Oryza sativa (japonica cultivar-group) geno... 341 3e-091
gb|AU183327.1|AU183327 AU183327 Rice cDNA from immature lea... 198 3e-048
ref|XM_475631.1| Oryza sativa (japonica cultivar-group), p... 198 3e-048
gb|AU165717.1|AU165717 AU165717 Rice panicle at flowering s... 190 7e-046
gb|AU182519.1|AU182519 AU182519 Rice panicle at flowering s... 190 7e-046
gb|AU184299.1|AU184299 AU184299 Rice root Oryza sativa (jap... 190 7e-046
gb|AU184331.1|AU184331 AU184331 Rice root Oryza sativa (jap... 190 7e-046
gb|CV721477.1|CV721477 YBH--04-E01.b1 Rice before heading y... 190 7e-046
gb|CV721494.1|CV721494 YBH--04-F01.b1 Rice before heading y... 190 7e-046
gb|AU184419.1|AU184419 AU184419 Rice root Oryza sativa (jap... 182 2e-043
gb|AC104276.2| Oryza sativa (japonica cultivar-group) chrom... 180 6e-043
gb|AC137614.2| Oryza sativa (japonica cultivar-group) chrom... 180 6e-043
gb|AACV01010931.1| Oryza sativa (japonica cultivar-group) c... 180 6e-043
gb|AC119288.4| Oryza sativa (japonica cultivar-group) chrom... 180 6e-043
ref|NT_107216.1| Oryza sativa (japonica cultivar-group) 180 6e-043
gb|CH401191.1| Oryza sativa (japonica cultivar-group) chrom... 180 6e-043
gb|CM000142.1| Oryza sativa (japonica cultivar-group) chrom... 180 6e-043
dbj|AP008211.1| Oryza sativa (japonica cultivar-group) geno... 180 6e-043
gb|AU182670.1|AU182670 AU182670 Rice panicle (longer than 1... 176 1e-041
gb|AU183328.1|AU183328 AU183328 Rice cDNA from immature lea... 170 6e-040
gb|AU183333.1|AU183333 AU183333 Rice cDNA from immature lea... 149 2e-033
gb|C99089.1|C99089 C99089 Rice panicle at flowering stage O... 127 8e-027
gb|AU184823.1|AU184823 AU184823 Rice cDNA from young root O... 127 8e-027
gb|CV721235.1|CV721235 YBH--03-G09.b1 Rice before heading y... 119 2e-024
gb|CV721634.1|CV721634 YBH--04-M15.b1 Rice before heading y... 119 2e-024
ref|XM_472425.1| Oryza sativa (japonica cultivar-group), p... 119 2e-024
gb|CV720933.1|CV720933 YBH--02-F09.b1 Rice before heading y... 115 3e-023
gb|CV721396.1|CV721396 YBH--03-P10.b1 Rice before heading y... 113 1e-022
gb|CV721349.1|CV721349 YBH--03-M13.b1 Rice before heading y... 84 1e-013
gb|CV721865.1|CV721865 YBH--05-J14.b1 Rice before heading y... 84 1e-013
gb|C99088.1|C99088 C99088 Rice panicle at flowering stage O... 82 4e-013
gb|AU064186.1|AU064186 AU064186 Rice panicle at flowering s... 66 3e-008
gb|CV722007.1|CV722007 YBH--06-B04.b1 Rice before heading y... 62 4e-007
dbj|AK062916.1| Oryza sativa (japonica cultivar-group) cDNA... 56 3e-005
dbj|AK105208.1| Oryza sativa (japonica cultivar-group) cDNA... 56 3e-005
dbj|BA000010.8| Oryza sativa (japonica cultivar-group) geno... 56 3e-005
ref|NT_079927.2| Oryza sativa (japonica cultivar-group) 56 3e-005
dbj|AP004127.1| Oryza sativa (japonica cultivar-group) geno... 56 3e-005
dbj|AP008207.1| Oryza sativa (japonica cultivar-group) geno... 56 3e-005
gb|C73643.2|C73643 C73643 Rice panicle (longer than 10cm) O... 48 0.006
gb|AQ913446.1|AQ913446 nbeb0041J21f CUGI Rice BAC Library (... 46 0.024
gb|D24434.1|D24434 RICR1885A Rice root Oryza sativa (japoni... 46 0.024
gb|CD670686.1|CD670686 OsMR101 5MT resistant rice mutant cD... 46 0.024
gb|C73730.1|C73730 C73730 Rice panicle (longer than 10cm) O... 44 0.096
gb|AU064024.1|AU064024 AU064024 Rice panicle at flowering s... 44 0.096
gb|AACV01002674.1| Oryza sativa (japonica cultivar-group) c... 44 0.096
gb|CH401168.1| Oryza sativa (japonica cultivar-group) chrom... 44 0.096
gb|CM000138.1| Oryza sativa (japonica cultivar-group) chrom... 44 0.096
gb|AACV01016464.1| Oryza sativa (japonica cultivar-group) c... 42 0.38
dbj|AP003863.3| Oryza sativa (japonica cultivar-group) geno... 42 0.38
ref|NT_079899.2| Oryza sativa (japonica cultivar-group) 42 0.38
gb|CH401226.1| Oryza sativa (japonica cultivar-group) chrom... 42 0.38
gb|CM000144.1| Oryza sativa (japonica cultivar-group) chrom... 42 0.38
dbj|AP008213.1| Oryza sativa (japonica cultivar-group) geno... 42 0.38
>ref|XM_472424.1| Oryza sativa (japonica cultivar-group), predicted mRNA
Length = 351
Score = 375 bits (189), Expect = e-101
Identities = 252/273 (92%)
Strand = Plus / Minus
Query: 298 tcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcg 357
|||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||
Sbjct: 351 tcatggcagagtgtaatctccgcacttgtagccgacggggcggtcggcgatgttgcagcg 292
Query: 358 cttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacag 417
|||||||||||||||||| ||||||||||||||||||| ||| ||| ||| |||||||
Sbjct: 291 cttggggatggtgatggcgacctcgggcttgatcccggcgttcctggtcgtgctggacag 232
Query: 418 catgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagca 477
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 231 catgacggcgcagaggcacttggggctctgcttcccgatggtgtgcaccgccgtgcagca 172
Query: 478 gccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttcag 537
||| | ||||||| ||| |||||| || ||||| |||||||||||||||||||||||
Sbjct: 171 cccgctcgacggcgtcgacttggggtccttggccgccgacgcgcacggcgccagcttcag 112
Query: 538 cgccatcctgtccggcggcgtcgccccgcactc 570
||||||| |||||||||||||||||||||||||
Sbjct: 111 cgccatcttgtccggcggcgtcgccccgcactc 79
>gb|CA756111.1|CA756111 BR030035000_PLATE_C06_43_040.ab1 OA Oryza sativa (japonica
cultivar-group) cDNA clone
BR030035000_PLATE_C06_43_040.ab1 similar to NP_568160.1|
(NM_120678) putative protein [Arabidopsis thaliana]
gi|21592534|gb|AAM64483.1| (AY086919) unknown
[Arabidopsis thaliana], mRNA sequence
Length = 628
Score = 371 bits (187), Expect = e-100
Identities = 253/275 (92%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||
Sbjct: 441 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcggcgatgttgcag 382
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
|||||||||||||||||||| ||||||||||||||||| | ||| ||| ||| |||||
Sbjct: 381 cgcttggggatggtgatggcgacctcgggcttgatccccgcgttcctggtcgtgctggac 322
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 321 agcatgacggcgcagaggcacttggggctctgcttcccgatggtgtgcaccgccgtgcag 262
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| | ||||||| ||| |||||| || ||||| |||||||||||||||||||||
Sbjct: 261 cacccgctcgacggcgtcgacttggggtccttggccgccgacgcgcacggcgccagcttc 202
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactc 570
||||||||| |||||||||||||||||||||||||
Sbjct: 201 agcgccatcttgtccggcggcgtcgccccgcactc 167
>dbj|AK110485.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-167-B02, full
insert sequence
Length = 3096
Score = 371 bits (187), Expect = e-100
Identities = 253/275 (92%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcag 355
|||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||
Sbjct: 2801 gctcatggcagagtgtaatctccgcacttgtagccgacggggcggtcggcgatgttgcag 2742
Query: 356 cgcttggggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggac 415
|||||||||||||||||||| ||||||||||||||||||| ||| ||| ||| |||||
Sbjct: 2741 cgcttggggatggtgatggcgacctcgggcttgatcccggcgttcctggtcgtgctggac 2682
Query: 416 agcatgacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcag 475
|||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||
Sbjct: 2681 agcatgacggcgcagaggcacttggggctctgcttcccaatggtgtgcaccgccgtgcag 2622
Query: 476 cagccgttggacggcgccgagctggggttctgcgccgcggacgcgcacggcgccagcttc 535
|| ||| | ||||||| ||| |||||| || ||||| |||||||||||||||||||||
Sbjct: 2621 cacccgctcgacggcgtcgacttggggtccttggccgccgacgcgcacggcgccagcttc 2562
Query: 536 agcgccatcctgtccggcggcgtcgccccgcactc 570
||||||||| |||||||||||||||||||||||||
Sbjct: 2561 agcgccatcttgtccggcggcgtcgccccgcactc 2527
>emb|AL606451.1|OSJN00006 Oryza sativa (japonica cultivar-group) chromosome 4 clone OJ1217_H10,
*** SEQUENCING IN PROGRESS ***
Length = 84487
Score = 341 bits (172), Expect = 3e-091
Identities = 235/256 (91%)
Strand = Plus / Minus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||
Sbjct: 83498 ctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttggggatggtgatgg 83439
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||||||||||||||||| ||| ||| ||| ||||||||||||||||||||||||
Sbjct: 83438 cgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatgacggcgcagaggc 83379
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
||| ||||||||||||||||||||||||||||||||||||||| ||| | ||||||| ||
Sbjct: 83378 acttggggctctgcttcccgatggtgtgcaccgccgtgcagcacccgctcgacggcgtcg 83319
Query: 495 agctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcg 554
| |||||| || ||||| |||||||||||||||||||||||||||||| |||||||||
Sbjct: 83318 acttggggtccttggccgccgacgcgcacggcgccagcttcagcgccatcttgtccggcg 83259
Query: 555 gcgtcgccccgcactc 570
||||||||||||||||
Sbjct: 83258 gcgtcgccccgcactc 83243
Score = 42.1 bits (21), Expect = 0.38
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatct 316
|||||||||||||||||||||
Sbjct: 83807 gctcatggcagagtgtaatct 83787
>gb|AACV01009713.1| Oryza sativa (japonica cultivar-group) chromosome 4 Ctg009713, whole
genome shotgun sequence
Length = 19998
Score = 341 bits (172), Expect = 3e-091
Identities = 235/256 (91%)
Strand = Plus / Minus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||
Sbjct: 3974 ctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttggggatggtgatgg 3915
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||||||||||||||||| ||| ||| ||| ||||||||||||||||||||||||
Sbjct: 3914 cgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatgacggcgcagaggc 3855
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
||| ||||||||||||||||||||||||||||||||||||||| ||| | ||||||| ||
Sbjct: 3854 acttggggctctgcttcccgatggtgtgcaccgccgtgcagcacccgctcgacggcgtcg 3795
Query: 495 agctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcg 554
| |||||| || ||||| |||||||||||||||||||||||||||||| |||||||||
Sbjct: 3794 acttggggtccttggccgccgacgcgcacggcgccagcttcagcgccatcttgtccggcg 3735
Query: 555 gcgtcgccccgcactc 570
||||||||||||||||
Sbjct: 3734 gcgtcgccccgcactc 3719
Score = 113 bits (57), Expect = 1e-022
Identities = 69/73 (94%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||||
Sbjct: 7680 ccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatggtgatggcc 7621
Query: 377 acctcgggcttga 389
||||| |||||||
Sbjct: 7620 acctccggcttga 7608
Score = 61.9 bits (31), Expect = 4e-007
Identities = 67/79 (84%)
Strand = Plus / Minus
Query: 499 ggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgt 558
||||| ||||||||| |||||||||||||||||||||||||| | | |||| ||||||
Sbjct: 7495 ggggtcctgcgccgccttcgcgcacggcgccagcttcagcgccaccttctccgccggcgt 7436
Query: 559 cgccccgcactcgcccgcg 577
| ||||||| |||||||
Sbjct: 7435 cttgccgcacttgcccgcg 7417
Score = 42.1 bits (21), Expect = 0.38
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatct 316
|||||||||||||||||||||
Sbjct: 4283 gctcatggcagagtgtaatct 4263
>ref|NT_107198.1| Oryza sativa (japonica cultivar-group)
Length = 632744
Score = 341 bits (172), Expect = 3e-091
Identities = 235/256 (91%)
Strand = Plus / Minus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||
Sbjct: 283504 ctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttggggatggtgatgg 283445
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||||||||||||||||| ||| ||| ||| ||||||||||||||||||||||||
Sbjct: 283444 cgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatgacggcgcagaggc 283385
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
||| ||||||||||||||||||||||||||||||||||||||| ||| | ||||||| ||
Sbjct: 283384 acttggggctctgcttcccgatggtgtgcaccgccgtgcagcacccgctcgacggcgtcg 283325
Query: 495 agctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcg 554
| |||||| || ||||| |||||||||||||||||||||||||||||| |||||||||
Sbjct: 283324 acttggggtccttggccgccgacgcgcacggcgccagcttcagcgccatcttgtccggcg 283265
Query: 555 gcgtcgccccgcactc 570
||||||||||||||||
Sbjct: 283264 gcgtcgccccgcactc 283249
Score = 113 bits (57), Expect = 1e-022
Identities = 69/73 (94%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||||
Sbjct: 287211 ccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatggtgatggcc 287152
Query: 377 acctcgggcttga 389
||||| |||||||
Sbjct: 287151 acctccggcttga 287139
Score = 61.9 bits (31), Expect = 4e-007
Identities = 67/79 (84%)
Strand = Plus / Minus
Query: 499 ggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgt 558
||||| ||||||||| |||||||||||||||||||||||||| | | |||| ||||||
Sbjct: 287026 ggggtcctgcgccgccttcgcgcacggcgccagcttcagcgccaccttctccgccggcgt 286967
Query: 559 cgccccgcactcgcccgcg 577
| ||||||| |||||||
Sbjct: 286966 cttgccgcacttgcccgcg 286948
Score = 42.1 bits (21), Expect = 0.38
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatct 316
|||||||||||||||||||||
Sbjct: 283813 gctcatggcagagtgtaatct 283793
>gb|CH401189.1| Oryza sativa (japonica cultivar-group) chromosome 4 scaffold000026 genomic
scaffold, whole genome shotgun sequence
Length = 11796637
Score = 341 bits (172), Expect = 3e-091
Identities = 235/256 (91%)
Strand = Plus / Minus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||
Sbjct: 10341460 ctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttggggatggtgatgg 10341401
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||||||||||||||||| ||| ||| ||| ||||||||||||||||||||||||
Sbjct: 10341400 cgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatgacggcgcagaggc 10341341
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
||| ||||||||||||||||||||||||||||||||||||||| ||| | ||||||| ||
Sbjct: 10341340 acttggggctctgcttcccgatggtgtgcaccgccgtgcagcacccgctcgacggcgtcg 10341281
Query: 495 agctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcg 554
| |||||| || ||||| |||||||||||||||||||||||||||||| |||||||||
Sbjct: 10341280 acttggggtccttggccgccgacgcgcacggcgccagcttcagcgccatcttgtccggcg 10341221
Query: 555 gcgtcgccccgcactc 570
||||||||||||||||
Sbjct: 10341220 gcgtcgccccgcactc 10341205
Score = 113 bits (57), Expect = 1e-022
Identities = 69/73 (94%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||||
Sbjct: 10345166 ccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatggtgatggcc 10345107
Query: 377 acctcgggcttga 389
||||| |||||||
Sbjct: 10345106 acctccggcttga 10345094
Score = 61.9 bits (31), Expect = 4e-007
Identities = 67/79 (84%)
Strand = Plus / Minus
Query: 499 ggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgt 558
||||| ||||||||| |||||||||||||||||||||||||| | | |||| ||||||
Sbjct: 10344981 ggggtcctgcgccgccttcgcgcacggcgccagcttcagcgccaccttctccgccggcgt 10344922
Query: 559 cgccccgcactcgcccgcg 577
| ||||||| |||||||
Sbjct: 10344921 cttgccgcacttgcccgcg 10344903
Score = 42.1 bits (21), Expect = 0.38
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatct 316
|||||||||||||||||||||
Sbjct: 10341769 gctcatggcagagtgtaatct 10341749
>gb|CM000141.1| Oryza sativa (japonica cultivar-group) chromosome 4, whole genome shotgun
sequence
Length = 32311234
Score = 341 bits (172), Expect = 3e-091
Identities = 235/256 (91%)
Strand = Plus / Minus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||
Sbjct: 17688822 ctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttggggatggtgatgg 17688763
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||||||||||||||||| ||| ||| ||| ||||||||||||||||||||||||
Sbjct: 17688762 cgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatgacggcgcagaggc 17688703
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
||| ||||||||||||||||||||||||||||||||||||||| ||| | ||||||| ||
Sbjct: 17688702 acttggggctctgcttcccgatggtgtgcaccgccgtgcagcacccgctcgacggcgtcg 17688643
Query: 495 agctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcg 554
| |||||| || ||||| |||||||||||||||||||||||||||||| |||||||||
Sbjct: 17688642 acttggggtccttggccgccgacgcgcacggcgccagcttcagcgccatcttgtccggcg 17688583
Query: 555 gcgtcgccccgcactc 570
||||||||||||||||
Sbjct: 17688582 gcgtcgccccgcactc 17688567
Score = 113 bits (57), Expect = 1e-022
Identities = 69/73 (94%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||||
Sbjct: 17692528 ccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatggtgatggcc 17692469
Query: 377 acctcgggcttga 389
||||| |||||||
Sbjct: 17692468 acctccggcttga 17692456
Score = 61.9 bits (31), Expect = 4e-007
Identities = 67/79 (84%)
Strand = Plus / Minus
Query: 499 ggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgt 558
||||| ||||||||| |||||||||||||||||||||||||| | | |||| ||||||
Sbjct: 17692343 ggggtcctgcgccgccttcgcgcacggcgccagcttcagcgccaccttctccgccggcgt 17692284
Query: 559 cgccccgcactcgcccgcg 577
| ||||||| |||||||
Sbjct: 17692283 cttgccgcacttgcccgcg 17692265
Score = 42.1 bits (21), Expect = 0.38
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatct 316
|||||||||||||||||||||
Sbjct: 17689131 gctcatggcagagtgtaatct 17689111
>emb|AL606453.2|OSJN00010 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ991214_12,
complete sequence
Length = 116952
Score = 341 bits (172), Expect = 3e-091
Identities = 235/256 (91%)
Strand = Plus / Minus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||
Sbjct: 63499 ctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttggggatggtgatgg 63440
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||||||||||||||||| ||| ||| ||| ||||||||||||||||||||||||
Sbjct: 63439 cgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatgacggcgcagaggc 63380
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
||| ||||||||||||||||||||||||||||||||||||||| ||| | ||||||| ||
Sbjct: 63379 acttggggctctgcttcccgatggtgtgcaccgccgtgcagcacccgctcgacggcgtcg 63320
Query: 495 agctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcg 554
| |||||| || ||||| |||||||||||||||||||||||||||||| |||||||||
Sbjct: 63319 acttggggtccttggccgccgacgcgcacggcgccagcttcagcgccatcttgtccggcg 63260
Query: 555 gcgtcgccccgcactc 570
||||||||||||||||
Sbjct: 63259 gcgtcgccccgcactc 63244
Score = 113 bits (57), Expect = 1e-022
Identities = 69/73 (94%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||||
Sbjct: 67206 ccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatggtgatggcc 67147
Query: 377 acctcgggcttga 389
||||| |||||||
Sbjct: 67146 acctccggcttga 67134
Score = 61.9 bits (31), Expect = 4e-007
Identities = 67/79 (84%)
Strand = Plus / Minus
Query: 499 ggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgt 558
||||| ||||||||| |||||||||||||||||||||||||| | | |||| ||||||
Sbjct: 67021 ggggtcctgcgccgccttcgcgcacggcgccagcttcagcgccaccttctccgccggcgt 66962
Query: 559 cgccccgcactcgcccgcg 577
| ||||||| |||||||
Sbjct: 66961 cttgccgcacttgcccgcg 66943
Score = 42.1 bits (21), Expect = 0.38
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatct 316
|||||||||||||||||||||
Sbjct: 63808 gctcatggcagagtgtaatct 63788
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
sequence
Length = 35498469
Score = 341 bits (172), Expect = 3e-091
Identities = 235/256 (91%)
Strand = Plus / Minus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||
Sbjct: 20552871 ctccgcacttgtagccgacggggcggtcggcgatgttgcagcgcttggggatggtgatgg 20552812
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||||||||||||||||| ||| ||| ||| ||||||||||||||||||||||||
Sbjct: 20552811 cgacctcgggcttgatcccggcgttcctggtcgtgctggacagcatgacggcgcagaggc 20552752
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
||| ||||||||||||||||||||||||||||||||||||||| ||| | ||||||| ||
Sbjct: 20552751 acttggggctctgcttcccgatggtgtgcaccgccgtgcagcacccgctcgacggcgtcg 20552692
Query: 495 agctggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcg 554
| |||||| || ||||| |||||||||||||||||||||||||||||| |||||||||
Sbjct: 20552691 acttggggtccttggccgccgacgcgcacggcgccagcttcagcgccatcttgtccggcg 20552632
Query: 555 gcgtcgccccgcactc 570
||||||||||||||||
Sbjct: 20552631 gcgtcgccccgcactc 20552616
Score = 113 bits (57), Expect = 1e-022
Identities = 69/73 (94%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||||
Sbjct: 20556578 ccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatggtgatggcc 20556519
Query: 377 acctcgggcttga 389
||||| |||||||
Sbjct: 20556518 acctccggcttga 20556506
Score = 61.9 bits (31), Expect = 4e-007
Identities = 67/79 (84%)
Strand = Plus / Minus
Query: 499 ggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgt 558
||||| ||||||||| |||||||||||||||||||||||||| | | |||| ||||||
Sbjct: 20556393 ggggtcctgcgccgccttcgcgcacggcgccagcttcagcgccaccttctccgccggcgt 20556334
Query: 559 cgccccgcactcgcccgcg 577
| ||||||| |||||||
Sbjct: 20556333 cttgccgcacttgcccgcg 20556315
Score = 42.1 bits (21), Expect = 0.38
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 296 gctcatggcagagtgtaatct 316
|||||||||||||||||||||
Sbjct: 20553180 gctcatggcagagtgtaatct 20553160
>gb|AU183327.1|AU183327 AU183327 Rice cDNA from immature leaf including apical meristem
(under short day condition) Oryza sativa (japonica
cultivar-group) cDNA clone E61684, mRNA sequence
Length = 444
Score = 198 bits (100), Expect = 3e-048
Identities = 209/242 (86%), Gaps = 5/242 (2%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 414 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 355
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||| ||||| ||||||||||||| | ||||||| |||||||||||
Sbjct: 354 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 295
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| ||||||||| |||||||||||||||||||| |||||||| |
Sbjct: 294 acggcgcacaggcagctggggctctg---cccgatggtgtgcaccgccgagcagcagctg 238
Query: 482 ttggacggcgccgagctg-gggttctgcgccgcggacgcgcacggcgccagcttcagcgc 540
| ||||||||||| ||| |||| | |||||| ||| |||||||||||||| ||||||
Sbjct: 237 ctcgacggcgccga-ctgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgc 179
Query: 541 ca 542
||
Sbjct: 178 ca 177
>ref|XM_475631.1| Oryza sativa (japonica cultivar-group), predicted mRNA
Length = 354
Score = 198 bits (100), Expect = 3e-048
Identities = 209/242 (86%), Gaps = 5/242 (2%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 350 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 291
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||| ||||| ||||||||||||| | ||||||| |||||||||||
Sbjct: 290 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 231
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| ||||||||| |||||||||||||||||||| |||||||| |
Sbjct: 230 acggcgcacaggcagctggggctctg---cccgatggtgtgcaccgccgagcagcagctg 174
Query: 482 ttggacggcgccgagctg-gggttctgcgccgcggacgcgcacggcgccagcttcagcgc 540
| ||||||||||| ||| |||| | |||||| ||| |||||||||||||| ||||||
Sbjct: 173 ctcgacggcgccga-ctgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgc 115
Query: 541 ca 542
||
Sbjct: 114 ca 113
>gb|AU165717.1|AU165717 AU165717 Rice panicle at flowering stage Oryza sativa (japonica
cultivar-group) cDNA clone E4182, mRNA sequence
Length = 676
Score = 190 bits (96), Expect = 7e-046
Identities = 170/194 (87%), Gaps = 3/194 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 434 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 375
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||| ||||| ||||||||||||| | ||||||| |||||||||||
Sbjct: 374 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 315
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| ||||||||| |||||||||||||||||||| |||||||| |
Sbjct: 314 acggcgcacaggcagctggggctctg---cccgatggtgtgcaccgccgagcagcagctg 258
Query: 482 ttggacggcgccga 495
| |||||||||||
Sbjct: 257 ctcgacggcgccga 244
>gb|AU182519.1|AU182519 AU182519 Rice panicle at flowering stage Oryza sativa (japonica
cultivar-group) cDNA clone E3418, mRNA sequence
Length = 453
Score = 190 bits (96), Expect = 7e-046
Identities = 170/194 (87%), Gaps = 3/194 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 209 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 150
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||| ||||| ||||||||||||| | ||||||| |||||||||||
Sbjct: 149 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 90
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| ||||||||| |||||||||||||||||||| |||||||| |
Sbjct: 89 acggcgcacaggcagctggggctctg---cccgatggtgtgcaccgccgagcagcagctg 33
Query: 482 ttggacggcgccga 495
| |||||||||||
Sbjct: 32 ctcgacggcgccga 19
>gb|AU184299.1|AU184299 AU184299 Rice root Oryza sativa (japonica cultivar-group) cDNA
clone R1885, mRNA sequence
Length = 449
Score = 190 bits (96), Expect = 7e-046
Identities = 170/194 (87%), Gaps = 3/194 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 212 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 153
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||| ||||| ||||||||||||| | ||||||| |||||||||||
Sbjct: 152 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 93
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| ||||||||| |||||||||||||||||||| |||||||| |
Sbjct: 92 acggcgcacaggcagctggggctctg---cccgatggtgtgcaccgccgagcagcagctg 36
Query: 482 ttggacggcgccga 495
| |||||||||||
Sbjct: 35 ctcgacggcgccga 22
>gb|AU184331.1|AU184331 AU184331 Rice root Oryza sativa (japonica cultivar-group) cDNA
clone R1979, mRNA sequence
Length = 451
Score = 190 bits (96), Expect = 7e-046
Identities = 170/194 (87%), Gaps = 3/194 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 214 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 155
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||| ||||| ||||||||||||| | ||||||| |||||||||||
Sbjct: 154 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 95
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| ||||||||| |||||||||||||||||||| |||||||| |
Sbjct: 94 acggcgcacaggcagctggggctctg---cccgatggtgtgcaccgccgagcagcagctg 38
Query: 482 ttggacggcgccga 495
| |||||||||||
Sbjct: 37 ctcgacggcgccga 24
>gb|CV721477.1|CV721477 YBH--04-E01.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--04-E01, mRNA sequence
Length = 460
Score = 190 bits (96), Expect = 7e-046
Identities = 208/242 (85%), Gaps = 5/242 (2%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 283 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 224
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||| ||||| ||||||||||||| | ||||||| |||||||||||
Sbjct: 223 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 164
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| ||||||||| |||||||||||||||||||| ||||||| |
Sbjct: 163 acggcgcacaggcagctggggctctg---cccgatggtgtgcaccgccgagcagcagatg 107
Query: 482 ttggacggcgccgagctg-gggttctgcgccgcggacgcgcacggcgccagcttcagcgc 540
| ||||||||||| ||| |||| | |||||| ||| |||||||||||||| ||||||
Sbjct: 106 ctcgacggcgccga-ctgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgc 48
Query: 541 ca 542
||
Sbjct: 47 ca 46
>gb|CV721494.1|CV721494 YBH--04-F01.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--04-F01, mRNA sequence
Length = 460
Score = 190 bits (96), Expect = 7e-046
Identities = 208/242 (85%), Gaps = 5/242 (2%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 283 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 224
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||| ||||| ||||||||||||| | ||||||| |||||||||||
Sbjct: 223 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 164
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccg 481
|||||||| ||||| ||||||||| |||||||||||||||||||| ||||||| |
Sbjct: 163 acggcgcacaggcagctggggctctg---cccgatggtgtgcaccgccgagcagcagatg 107
Query: 482 ttggacggcgccgagctg-gggttctgcgccgcggacgcgcacggcgccagcttcagcgc 540
| ||||||||||| ||| |||| | |||||| ||| |||||||||||||| ||||||
Sbjct: 106 ctcgacggcgccga-ctgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgc 48
Query: 541 ca 542
||
Sbjct: 47 ca 46
>gb|AU184419.1|AU184419 AU184419 Rice root Oryza sativa (japonica cultivar-group) cDNA
clone R2228, mRNA sequence
Length = 454
Score = 182 bits (92), Expect = 2e-043
Identities = 157/178 (88%), Gaps = 3/178 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 179 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 120
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||| ||||| ||||||||||||| | ||||||| |||||||||||
Sbjct: 119 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 60
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479
|||||||| ||||| ||||||||| |||||||||||||||||||| ||||||||
Sbjct: 59 acggcgcacaggcagctggggctctg---cccgatggtgtgcaccgccgagcagcagc 5
>gb|AC104276.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1231_F08,
complete sequence
Length = 118049
Score = 180 bits (91), Expect = 6e-043
Identities = 197/229 (86%), Gaps = 5/229 (2%)
Strand = Plus / Plus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||
Sbjct: 47418 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 47477
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||| ||||||||||||| | ||||||| ||||||||||| |||||||| ||||
Sbjct: 47478 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 47537
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
| ||||||||| |||||||||||||||||||| |||||||| | | ||||||||||
Sbjct: 47538 agctggggctctg---cccgatggtgtgcaccgccgagcagcagctgctcgacggcgccg 47594
Query: 495 agctg-gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
| ||| |||| | |||||| ||| |||||||||||||| ||||||||
Sbjct: 47595 a-ctgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgcca 47642
>gb|AC137614.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
OSJNBa0034O12, complete sequence
Length = 156263
Score = 180 bits (91), Expect = 6e-043
Identities = 197/229 (86%), Gaps = 5/229 (2%)
Strand = Plus / Plus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||
Sbjct: 45767 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 45826
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||| ||||||||||||| | ||||||| ||||||||||| |||||||| ||||
Sbjct: 45827 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 45886
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
| ||||||||| |||||||||||||||||||| |||||||| | | ||||||||||
Sbjct: 45887 agctggggctctg---cccgatggtgtgcaccgccgagcagcagctgctcgacggcgccg 45943
Query: 495 agctg-gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
| ||| |||| | |||||| ||| |||||||||||||| ||||||||
Sbjct: 45944 a-ctgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgcca 45991
>gb|AACV01010931.1| Oryza sativa (japonica cultivar-group) chromosome 5 Ctg010931, whole
genome shotgun sequence
Length = 25588
Score = 180 bits (91), Expect = 6e-043
Identities = 197/229 (86%), Gaps = 5/229 (2%)
Strand = Plus / Minus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||
Sbjct: 4819 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 4760
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||| ||||||||||||| | ||||||| ||||||||||| |||||||| ||||
Sbjct: 4759 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 4700
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
| ||||||||| |||||||||||||||||||| |||||||| | | ||||||||||
Sbjct: 4699 agctggggctctg---cccgatggtgtgcaccgccgagcagcagctgctcgacggcgccg 4643
Query: 495 agctg-gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
| ||| |||| | |||||| ||| |||||||||||||| ||||||||
Sbjct: 4642 a-ctgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgcca 4595
>gb|AC119288.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0017J22,
complete sequence
Length = 177153
Score = 180 bits (91), Expect = 6e-043
Identities = 197/229 (86%), Gaps = 5/229 (2%)
Strand = Plus / Plus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||
Sbjct: 109618 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 109677
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||| ||||||||||||| | ||||||| ||||||||||| |||||||| ||||
Sbjct: 109678 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 109737
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
| ||||||||| |||||||||||||||||||| |||||||| | | ||||||||||
Sbjct: 109738 agctggggctctg---cccgatggtgtgcaccgccgagcagcagctgctcgacggcgccg 109794
Query: 495 agctg-gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
| ||| |||| | |||||| ||| |||||||||||||| ||||||||
Sbjct: 109795 a-ctgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgcca 109842
>ref|NT_107216.1| Oryza sativa (japonica cultivar-group)
Length = 2910826
Score = 180 bits (91), Expect = 6e-043
Identities = 197/229 (86%), Gaps = 5/229 (2%)
Strand = Plus / Plus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||
Sbjct: 2570523 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 2570582
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||| ||||||||||||| | ||||||| ||||||||||| |||||||| ||||
Sbjct: 2570583 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 2570642
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
| ||||||||| |||||||||||||||||||| |||||||| | | ||||||||||
Sbjct: 2570643 agctggggctctg---cccgatggtgtgcaccgccgagcagcagctgctcgacggcgccg 2570699
Query: 495 agctg-gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
| ||| |||| | |||||| ||| |||||||||||||| ||||||||
Sbjct: 2570700 a-ctgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgcca 2570747
>gb|CH401191.1| Oryza sativa (japonica cultivar-group) chromosome 5 scaffold000028 genomic
scaffold, whole genome shotgun sequence
Length = 7678539
Score = 180 bits (91), Expect = 6e-043
Identities = 197/229 (86%), Gaps = 5/229 (2%)
Strand = Plus / Plus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||
Sbjct: 3491497 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 3491556
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||| ||||||||||||| | ||||||| ||||||||||| |||||||| ||||
Sbjct: 3491557 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 3491616
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
| ||||||||| |||||||||||||||||||| |||||||| | | ||||||||||
Sbjct: 3491617 agctggggctctg---cccgatggtgtgcaccgccgagcagcagctgctcgacggcgccg 3491673
Query: 495 agctg-gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
| ||| |||| | |||||| ||| |||||||||||||| ||||||||
Sbjct: 3491674 a-ctgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgcca 3491721
>gb|CM000142.1| Oryza sativa (japonica cultivar-group) chromosome 5, whole genome shotgun
sequence
Length = 29309110
Score = 180 bits (91), Expect = 6e-043
Identities = 197/229 (86%), Gaps = 5/229 (2%)
Strand = Plus / Plus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||
Sbjct: 3491497 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 3491556
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||| ||||||||||||| | ||||||| ||||||||||| |||||||| ||||
Sbjct: 3491557 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 3491616
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
| ||||||||| |||||||||||||||||||| |||||||| | | ||||||||||
Sbjct: 3491617 agctggggctctg---cccgatggtgtgcaccgccgagcagcagctgctcgacggcgccg 3491673
Query: 495 agctg-gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
| ||| |||| | |||||| ||| |||||||||||||| ||||||||
Sbjct: 3491674 a-ctgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgcca 3491721
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
sequence
Length = 29737217
Score = 180 bits (91), Expect = 6e-043
Identities = 197/229 (86%), Gaps = 5/229 (2%)
Strand = Plus / Plus
Query: 315 ctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatgg 374
||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||
Sbjct: 3480136 ctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttggggatggtgatgg 3480195
Query: 375 ccacctcgggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggc 434
| ||||| ||||||||||||| | ||||||| ||||||||||| |||||||| ||||
Sbjct: 3480196 cgacctccggcttgatcccggcgaccctggccgtgttggacagcatcacggcgcacaggc 3480255
Query: 435 actgggggctctgcttcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccg 494
| ||||||||| |||||||||||||||||||| |||||||| | | ||||||||||
Sbjct: 3480256 agctggggctctg---cccgatggtgtgcaccgccgagcagcagctgctcgacggcgccg 3480312
Query: 495 agctg-gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
| ||| |||| | |||||| ||| |||||||||||||| ||||||||
Sbjct: 3480313 a-ctgcgggtcgtccgccgccgacacgcacggcgccagccgcagcgcca 3480360
>gb|AU182670.1|AU182670 AU182670 Rice panicle (longer than 10cm) Oryza sativa (japonica
cultivar-group) cDNA clone E20278, mRNA sequence
Length = 443
Score = 176 bits (89), Expect = 1e-041
Identities = 156/178 (87%), Gaps = 3/178 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 186 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 127
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||| ||||| ||||||||||||| | ||||||| |||||||||||
Sbjct: 126 gggatggtgatggcgacctccggcttgatcccggcgaccctggccgtgttggacagcatc 67
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479
|||||||| ||||| |||||| || |||||||||||||||||||| ||||||||
Sbjct: 66 acggcgcacaggcagctggggctntg---cccgatggtgtgcaccgccgagcagcagc 12
>gb|AU183328.1|AU183328 AU183328 Rice cDNA from immature leaf including apical meristem
(under short day condition) Oryza sativa (japonica
cultivar-group) cDNA clone E61684, mRNA sequence
Length = 438
Score = 170 bits (86), Expect = 6e-040
Identities = 154/177 (87%), Gaps = 3/177 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 174 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 115
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttggccgtcttggacagcatg 421
|||||||||||||| ||||| || |||||||||| | ||||||| |||||||||||
Sbjct: 114 gggatggtgatggcgacctccggnttgatcccggcgaccctggccgtgttggacagcatc 55
Query: 422 acggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcag 478
|||| ||| ||||| ||||||||| |||||||||||||||||||| |||||||
Sbjct: 54 acggngcacaggcagntggggctctg---cccgatggtgtgcaccgccgagcagcag 1
>gb|AU183333.1|AU183333 AU183333 Rice cDNA from immature leaf including apical meristem
(under short day condition) Oryza sativa (japonica
cultivar-group) cDNA clone E61773, mRNA sequence
Length = 439
Score = 149 bits (75), Expect = 2e-033
Identities = 154/179 (86%), Gaps = 4/179 (2%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 196 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 137
Query: 362 gggatggtgatggccacctcgggcttgatcccggacttcttgg-ccgtcttggacagcat 420
|||||||||||||| ||||| ||||| ||||| | | ||| |||| |||||||||||
Sbjct: 136 gggatggtgatggcgacctccggcttnatcccngcgaccctggcccgtgttggacagcat 77
Query: 421 gacggcgcagaggcactgggggctctgcttcccgatggtgtgcaccgccgtgcagcagc 479
|||| ||| ||||| ||||||||| |||||||||||||||||||| ||||||||
Sbjct: 76 cacggggcacaggcagctggggctctg---cccgatggtgtgcaccgccgagcagcagc 21
>gb|C99089.1|C99089 C99089 Rice panicle at flowering stage Oryza sativa (japonica
cultivar-group) cDNA clone E4433_2Z, mRNA sequence
Length = 349
Score = 127 bits (64), Expect = 8e-027
Identities = 88/95 (92%), Gaps = 1/95 (1%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||| ||||||||||||||||||||||||||| | | |||||||||||||
Sbjct: 101 ggcagcgtgtaatcnccgcacttgtagccgacggggcggtcggccatgttgcagcgcttg 42
Query: 362 gggatggtgatggccacct-cgggcttgatcccgg 395
|||||||||||||| |||| |||||||||||||||
Sbjct: 41 gggatggtgatggcgacctccgggcttgatcccgg 7
>gb|AU184823.1|AU184823 AU184823 Rice cDNA from young root Oryza sativa (japonica
cultivar-group) cDNA clone R10250, mRNA sequence
Length = 362
Score = 127 bits (64), Expect = 8e-027
Identities = 86/94 (91%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||||||||||||||||||||||||||||||||| | | |||| ||||||||
Sbjct: 144 ggcagcgtgtaatctccgcacttgtagccgacggggcggtcggccatgttgnagcgcttg 85
Query: 362 gggatggtgatggccacctcgggcttgatcccgg 395
|||||||||||||| ||| | |||||||||||||
Sbjct: 84 gggatggtgatggcgaccnccggcttgatcccgg 51
>gb|CV721235.1|CV721235 YBH--03-G09.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--03-G09, mRNA sequence
Length = 454
Score = 119 bits (60), Expect = 2e-024
Identities = 81/88 (92%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||| | ||||||||||||||||||||||||| | |||| ||||||||||||
Sbjct: 414 ggcagcgtgtaagcgccgcacttgtagccgacggggcggttggcgagtttgcagcgcttg 355
Query: 362 gggatggtgatggccacctcgggcttga 389
|||||||||||||||||||| |||||||
Sbjct: 354 gggatggtgatggccacctccggcttga 327
Score = 61.9 bits (31), Expect = 4e-007
Identities = 67/79 (84%)
Strand = Plus / Minus
Query: 499 ggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgt 558
||||| ||||||||| |||||||||||||||||||||||||| | | |||| ||||||
Sbjct: 214 ggggtcctgcgccgccttcgcgcacggcgccagcttcagcgccaccttctccgccggcgt 155
Query: 559 cgccccgcactcgcccgcg 577
| ||||||| |||||||
Sbjct: 154 cttgccgcacttgcccgcg 136
>gb|CV721634.1|CV721634 YBH--04-M15.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--04-M15, mRNA sequence
Length = 450
Score = 119 bits (60), Expect = 2e-024
Identities = 81/88 (92%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||| | ||||||||||||||||||||||||| | |||| ||||||||||||
Sbjct: 426 ggcagcgtgtaagcgccgcacttgtagccgacggggcggttggcgagtttgcagcgcttg 367
Query: 362 gggatggtgatggccacctcgggcttga 389
|||||||||||||||||||| |||||||
Sbjct: 366 gggatggtgatggccacctccggcttga 339
Score = 61.9 bits (31), Expect = 4e-007
Identities = 67/79 (84%)
Strand = Plus / Minus
Query: 499 ggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgt 558
||||| ||||||||| |||||||||||||||||||||||||| | | |||| ||||||
Sbjct: 226 ggggtcctgcgccgccttcgcgcacggcgccagcttcagcgccaccttctccgccggcgt 167
Query: 559 cgccccgcactcgcccgcg 577
| ||||||| |||||||
Sbjct: 166 cttgccgcacttgcccgcg 148
>ref|XM_472425.1| Oryza sativa (japonica cultivar-group), predicted mRNA
Length = 372
Score = 119 bits (60), Expect = 2e-024
Identities = 81/88 (92%)
Strand = Plus / Minus
Query: 302 ggcagagtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttg 361
||||| |||||| | ||||||||||||||||||||||||| | |||| ||||||||||||
Sbjct: 356 ggcagcgtgtaagcgccgcacttgtagccgacggggcggttggcgagtttgcagcgcttg 297
Query: 362 gggatggtgatggccacctcgggcttga 389
|||||||||||||||||||| |||||||
Sbjct: 296 gggatggtgatggccacctccggcttga 269
Score = 61.9 bits (31), Expect = 4e-007
Identities = 67/79 (84%)
Strand = Plus / Minus
Query: 499 ggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgt 558
||||| ||||||||| |||||||||||||||||||||||||| | | |||| ||||||
Sbjct: 156 ggggtcctgcgccgccttcgcgcacggcgccagcttcagcgccaccttctccgccggcgt 97
Query: 559 cgccccgcactcgcccgcg 577
| ||||||| |||||||
Sbjct: 96 cttgccgcacttgcccgcg 78
>gb|CV720933.1|CV720933 YBH--02-F09.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--02-F09, mRNA sequence
Length = 452
Score = 115 bits (58), Expect = 3e-023
Identities = 76/82 (92%)
Strand = Plus / Minus
Query: 308 gtgtaatctccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatg 367
|||||| | ||||||||||||||||||||||||| | |||| ||||||||||||||||||
Sbjct: 450 gtgtaagcgccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatg 391
Query: 368 gtgatggccacctcgggcttga 389
|||||||||||||| |||||||
Sbjct: 390 gtgatggccacctccggcttga 369
Score = 61.9 bits (31), Expect = 4e-007
Identities = 67/79 (84%)
Strand = Plus / Minus
Query: 499 ggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgt 558
||||| ||||||||| |||||||||||||||||||||||||| | | |||| ||||||
Sbjct: 256 ggggtcctgcgccgccttcgcgcacggcgccagcttcagcgccaccttctccgccggcgt 197
Query: 559 cgccccgcactcgcccgcg 577
| ||||||| |||||||
Sbjct: 196 cttgccgcacttgcccgcg 178
>gb|CV721396.1|CV721396 YBH--03-P10.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--03-P10, mRNA sequence
Length = 453
Score = 113 bits (57), Expect = 1e-022
Identities = 69/73 (94%)
Strand = Plus / Minus
Query: 317 ccgcacttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggcc 376
||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||||
Sbjct: 407 ccgcacttgtagccgacggggcggttggcgagtttgcagcgcttggggatggtgatggcc 348
Query: 377 acctcgggcttga 389
||||| |||||||
Sbjct: 347 acctccggcttga 335
Score = 61.9 bits (31), Expect = 4e-007
Identities = 67/79 (84%)
Strand = Plus / Minus
Query: 499 ggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgt 558
||||| ||||||||| |||||||||||||||||||||||||| | | |||| ||||||
Sbjct: 222 ggggtcctgcgccgccttcgcgcacggcgccagcttcagcgccaccttctccgccggcgt 163
Query: 559 cgccccgcactcgcccgcg 577
| ||||||| |||||||
Sbjct: 162 cttgccgcacttgcccgcg 144
>gb|CV721349.1|CV721349 YBH--03-M13.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--03-M13, mRNA sequence
Length = 433
Score = 83.8 bits (42), Expect = 1e-013
Identities = 80/90 (88%), Gaps = 2/90 (2%)
Strand = Plus / Plus
Query: 302 ggcagagtgtaatctccgcacttgtagccgac-ggggcggtcgacgaggttgcagcgctt 360
||||| |||||| | ||||||||||||||||| |||||||| | |||| |||||||||||
Sbjct: 285 ggcagcgtgtaagcgccgcacttgtagccgacgggggcggttggcgagtttgcagcgctt 344
Query: 361 ggggat-ggtgatggccacctcgggcttga 389
|||||| || |||||||||||| |||||||
Sbjct: 345 ggggatgggggatggccacctccggcttga 374
>gb|CV721865.1|CV721865 YBH--05-J14.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--05-J14, mRNA sequence
Length = 392
Score = 83.8 bits (42), Expect = 1e-013
Identities = 54/58 (93%)
Strand = Plus / Minus
Query: 332 acggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcgggcttga 389
|||||||||| | |||| |||||||||||||||||||||||||||||||| |||||||
Sbjct: 392 acggggcggttggcgagtttgcagcgcttggggatggtgatggccacctccggcttga 335
Score = 61.9 bits (31), Expect = 4e-007
Identities = 67/79 (84%)
Strand = Plus / Minus
Query: 499 ggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgt 558
||||| ||||||||| |||||||||||||||||||||||||| | | |||| ||||||
Sbjct: 222 ggggtcctgcgccgccttcgcgcacggcgccagcttcagcgccaccttctccgccggcgt 163
Query: 559 cgccccgcactcgcccgcg 577
| ||||||| |||||||
Sbjct: 162 cttgccgcacttgcccgcg 144
>gb|C99088.1|C99088 C99088 Rice panicle at flowering stage Oryza sativa (japonica
cultivar-group) cDNA clone E4433_1A, mRNA sequence
Length = 249
Score = 81.8 bits (41), Expect = 4e-013
Identities = 174/214 (81%), Gaps = 9/214 (4%)
Strand = Plus / Minus
Query: 331 gacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcgggcttgat 390
||||||||||||| | | ||||||||||||||||||||||||||| | ||| || |||||
Sbjct: 249 gacggggcggtcggcnatgttgcagcgcttggggatggtgatggcga-ctccggnttgat 191
Query: 391 cccggacttcttggccgtcttggacagcatgacggcgcagaggca-ctgggggctctgct 449
||||| | ||||||| || || || || |||||| | ||||| || ||| ||||
Sbjct: 190 cccggcgaccctggccgtgttnganagnatcacggcgnacaggcagct--gggntctg-- 135
Query: 450 tcccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctg-gggttctgc 508
|||||||||||||||||||| |||||||| | | ||||| ||||| ||| |||| | |
Sbjct: 134 -cccgatggtgtgcaccgccgagcagcagctgctcgacggngccga-ctgcgggtcgtcc 77
Query: 509 gccgcggacgcgcacggcgccagcttcagcgcca 542
||||| ||| |||||||||||||| ||||||||
Sbjct: 76 gccgccgacacgcacggcgccagccgcagcgcca 43
>gb|AU064186.1|AU064186 AU064186 Rice panicle at flowering stage Oryza sativa (japonica
cultivar-group) cDNA clone E4182_1A, mRNA sequence
Length = 319
Score = 65.9 bits (33), Expect = 3e-008
Identities = 80/93 (86%), Gaps = 2/93 (2%)
Strand = Plus / Minus
Query: 451 cccgatggtgtgcaccgccgtgcagcagccgttggacggcgccgagctg-gggttctgcg 509
|||||||||||||||||||| |||||||| | | ||||||||||| ||| |||| | ||
Sbjct: 286 cccgatggtgtgcaccgccgagcagcagctgctcgacggcgccga-ctgcgggtcgtccg 228
Query: 510 ccgcggacgcgcacggcgccagcttcagcgcca 542
|||| ||| |||||||||||||| ||||||||
Sbjct: 227 ccgccgacacgcacggcgccagccgcagcgcca 195
>gb|CV722007.1|CV722007 YBH--06-B04.b1 Rice before heading yeast two hybrid lambda phage
cDNA library (YBH) Oryza sativa (japonica
cultivar-group) cDNA clone YBH--06-B04, mRNA sequence
Length = 257
Score = 61.9 bits (31), Expect = 4e-007
Identities = 67/79 (84%)
Strand = Plus / Minus
Query: 499 ggggttctgcgccgcggacgcgcacggcgccagcttcagcgccatcctgtccggcggcgt 558
||||| ||||||||| |||||||||||||||||||||||||| | | |||| ||||||
Sbjct: 217 ggggtcctgcgccgccttcgcgcacggcgccagcttcagcgccaccttctccgccggcgt 158
Query: 559 cgccccgcactcgcccgcg 577
| ||||||| |||||||
Sbjct: 157 cttgccgcacttgcccgcg 139
>dbj|AK062916.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-108-H02, full
insert sequence
Length = 590
Score = 56.0 bits (28), Expect = 3e-005
Identities = 97/120 (80%)
Strand = Plus / Minus
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
||||| |||| |||||||| | ||| | |||||||||||||||||| |||||||| ||
Sbjct: 407 ttgtaaccgatggggcggttggcgatggcgcagcgcttggggatggtcatggccacggcg 348
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggggg 442
||||||| |||| || || || || ||||||||||||||||| ||||||| ||||
Sbjct: 347 ggcttgacgccggcgctccgcgcggtgttcgacagcatgacggcgcacaggcacttgggg 288
Score = 46.1 bits (23), Expect = 0.024
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 500 gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
|||||||||| || | |||||||||||||||||| |||||||
Sbjct: 233 gggttctgcgtggccgccgcgcacggcgccagcttaagcgcca 191
>dbj|AK105208.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-108-H09, full
insert sequence
Length = 702
Score = 56.0 bits (28), Expect = 3e-005
Identities = 97/120 (80%)
Strand = Plus / Minus
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
||||| |||| |||||||| | ||| | |||||||||||||||||| |||||||| ||
Sbjct: 407 ttgtaaccgatggggcggttggcgatggcgcagcgcttggggatggtcatggccacggcg 348
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggggg 442
||||||| |||| || || || || ||||||||||||||||| ||||||| ||||
Sbjct: 347 ggcttgacgccggcgctccgcgcggtgttcgacagcatgacggcgcacaggcacttgggg 288
Score = 46.1 bits (23), Expect = 0.024
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 500 gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
|||||||||| || | |||||||||||||||||| |||||||
Sbjct: 233 gggttctgcgtggccgccgcgcacggcgccagcttaagcgcca 191
>dbj|BA000010.8| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
sequence
Length = 43342410
Score = 56.0 bits (28), Expect = 3e-005
Identities = 97/120 (80%)
Strand = Plus / Plus
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
||||| |||| |||||||| | ||| | |||||||||||||||||| |||||||| ||
Sbjct: 36558341 ttgtaaccgatggggcggttggcgatggcgcagcgcttggggatggtcatggccacggcg 36558400
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggggg 442
||||||| |||| || || || || ||||||||||||||||| ||||||| ||||
Sbjct: 36558401 ggcttgacgccggcgctccgcgcggtgttcgacagcatgacggcgcacaggcacttgggg 36558460
Score = 46.1 bits (23), Expect = 0.024
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 500 gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
|||||||||| || | |||||||||||||||||| |||||||
Sbjct: 36558515 gggttctgcgtggccgccgcgcacggcgccagcttaagcgcca 36558557
>ref|NT_079927.2| Oryza sativa (japonica cultivar-group)
Length = 14818989
Score = 56.0 bits (28), Expect = 3e-005
Identities = 97/120 (80%)
Strand = Plus / Plus
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
||||| |||| |||||||| | ||| | |||||||||||||||||| |||||||| ||
Sbjct: 11005724 ttgtaaccgatggggcggttggcgatggcgcagcgcttggggatggtcatggccacggcg 11005783
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggggg 442
||||||| |||| || || || || ||||||||||||||||| ||||||| ||||
Sbjct: 11005784 ggcttgacgccggcgctccgcgcggtgttcgacagcatgacggcgcacaggcacttgggg 11005843
Score = 46.1 bits (23), Expect = 0.024
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 500 gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
|||||||||| || | |||||||||||||||||| |||||||
Sbjct: 11005898 gggttctgcgtggccgccgcgcacggcgccagcttaagcgcca 11005940
>dbj|AP004127.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
clone:P0005H10
Length = 142885
Score = 56.0 bits (28), Expect = 3e-005
Identities = 97/120 (80%)
Strand = Plus / Plus
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
||||| |||| |||||||| | ||| | |||||||||||||||||| |||||||| ||
Sbjct: 129510 ttgtaaccgatggggcggttggcgatggcgcagcgcttggggatggtcatggccacggcg 129569
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggggg 442
||||||| |||| || || || || ||||||||||||||||| ||||||| ||||
Sbjct: 129570 ggcttgacgccggcgctccgcgcggtgttcgacagcatgacggcgcacaggcacttgggg 129629
Score = 46.1 bits (23), Expect = 0.024
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 500 gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
|||||||||| || | |||||||||||||||||| |||||||
Sbjct: 129684 gggttctgcgtggccgccgcgcacggcgccagcttaagcgcca 129726
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
sequence
Length = 43261740
Score = 56.0 bits (28), Expect = 3e-005
Identities = 97/120 (80%)
Strand = Plus / Plus
Query: 323 ttgtagccgacggggcggtcgacgaggttgcagcgcttggggatggtgatggccacctcg 382
||||| |||| |||||||| | ||| | |||||||||||||||||| |||||||| ||
Sbjct: 36477671 ttgtaaccgatggggcggttggcgatggcgcagcgcttggggatggtcatggccacggcg 36477730
Query: 383 ggcttgatcccggacttcttggccgtcttggacagcatgacggcgcagaggcactggggg 442
||||||| |||| || || || || ||||||||||||||||| ||||||| ||||
Sbjct: 36477731 ggcttgacgccggcgctccgcgcggtgttcgacagcatgacggcgcacaggcacttgggg 36477790
Score = 46.1 bits (23), Expect = 0.024
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 500 gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
|||||||||| || | |||||||||||||||||| |||||||
Sbjct: 36477845 gggttctgcgtggccgccgcgcacggcgccagcttaagcgcca 36477887
>gb|C73643.2|C73643 C73643 Rice panicle (longer than 10cm) Oryza sativa (japonica
cultivar-group) cDNA clone E20043_2A, mRNA sequence
Length = 271
Score = 48.1 bits (24), Expect = 0.006
Identities = 36/40 (90%)
Strand = Plus / Minus
Query: 520 gcacggcgccagcttcagcgccatcctgtccggcggcgtc 559
||||||||||||||||||||||| | | |||| |||||||
Sbjct: 192 gcacggcgccagcttcagcgccaccttctccgccggcgtc 153
>gb|AQ913446.1|AQ913446 nbeb0041J21f CUGI Rice BAC Library (EcoRI) Oryza sativa (japonica
cultivar-group) genomic clone nbeb0041J21f, DNA sequence
Length = 450
Score = 46.1 bits (23), Expect = 0.024
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 500 gggttctgcgccgcggacgcgcacggcgccagcttcagcgcca 542
|||||||||| || | |||||||||||||||||| |||||||
Sbjct: 351 gggttctgcgtggccgccgcgcacggcgccagcttaagcgcca 309
Score = 44.1 bits (22), Expect = 0.096
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 413 gacagcatgacggcgcagaggcactggggg 442
||||||||||||||||| ||||||| ||||
Sbjct: 435 gacagcatgacggcgcacaggcacttgggg 406
Database: Oryza_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:41 PM
Number of letters in database: 2,800,419,916
Number of sequences in database: 438,736
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 865,229
Number of Sequences: 438736
Number of extensions: 865229
Number of successful extensions: 6745
Number of sequences better than 0.5: 63
Number of HSP's better than 0.5 without gapping: 63
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 6327
Number of HSP's gapped (non-prelim): 362
length of query: 673
length of database: 2,800,419,916
effective HSP length: 21
effective length of query: 652
effective length of database: 2,791,206,460
effective search space: 1819866611920
effective search space used: 1819866611920
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)