BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCS16e03.yg.2.1
(608 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AL375990.1|AL375990 MtBB20E07F1 MtBB Medicago truncatula... 66 4e-009
gb|CX534453.1|CX534453 s13dNF76B04MJ029_328507 Methyl Jasmo... 66 4e-009
gb|AJ500566.1|AJ500566 AJ500566 MTGIM Medicago truncatula c... 46 0.003
gb|AJ500301.1|AJ500301 AJ500301 MTGIM Medicago truncatula c... 42 0.053
gb|AJ548087.1|AJ548087 AJ548087 MTAPHEU Medicago truncatula... 42 0.053
gb|AJ621860.1|AJ621860 AJ621860 Medicago truncatula J5 root... 42 0.053
gb|AW686764.1|AW686764 NF042E06NR1F1000 Nodulated root Medi... 40 0.21
gb|AJ500181.1|AJ500181 AJ500181 MTGIM Medicago truncatula c... 40 0.21
gb|AJ500217.1|AJ500217 AJ500217 MTGIM Medicago truncatula c... 40 0.21
gb|AJ500711.1|AJ500711 AJ500711 MTGIM Medicago truncatula c... 40 0.21
gb|AJ864417.1|AJ864417 AJ864417 Medicago truncatula cv. J5 ... 40 0.21
gb|AC147538.15| Medicago truncatula clone mth2-135c7, WORKI... 40 0.21
gb|AC147538.16| Medicago truncatula clone mth2-135c7, WORKI... 40 0.21
>gb|AL375990.1|AL375990 MtBB20E07F1 MtBB Medicago truncatula cDNA clone MtBB20E07 T3, mRNA
sequence
Length = 494
Score = 65.9 bits (33), Expect = 4e-009
Identities = 93/113 (82%)
Strand = Plus / Minus
Query: 129 gcagtgaaggtgaaagtagaaccaacttggggtttacttgcaaatccaatctctcccctc 188
||||| || |||||||| |||||| || |||| ||||||||||||||| || || ||
Sbjct: 229 gcagtaaaagtgaaagtggaaccagtttttggttcacttgcaaatccaatttcaccattc 170
Query: 189 atgagtccaaccaagcatttgctgatgcttaatccaatgccagtgcccccatg 241
||||| |||||||| || ||||| ||||||| |||||| ||||| || |||||
Sbjct: 169 atgaggccaaccaaacacttgctaatgcttagtccaataccagttcctccatg 117
>gb|CX534453.1|CX534453 s13dNF76B04MJ029_328507 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 615
Score = 65.9 bits (33), Expect = 4e-009
Identities = 93/113 (82%)
Strand = Plus / Minus
Query: 129 gcagtgaaggtgaaagtagaaccaacttggggtttacttgcaaatccaatctctcccctc 188
||||| || |||||||| |||||| || |||| ||||||||||||||| || || ||
Sbjct: 148 gcagtaaaagtgaaagtggaaccagtttttggttcacttgcaaatccaatttcaccattc 89
Query: 189 atgagtccaaccaagcatttgctgatgcttaatccaatgccagtgcccccatg 241
||||| |||||||| || ||||| ||||||| |||||| ||||| || |||||
Sbjct: 88 atgaggccaaccaaacacttgctaatgcttagtccaataccagttcctccatg 36
>gb|AJ500566.1|AJ500566 AJ500566 MTGIM Medicago truncatula cDNA clone mtgmacc120017g10,
mRNA sequence
Length = 406
Score = 46.1 bits (23), Expect = 0.003
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtaccta 23
|||||||||||||||||||||||
Sbjct: 309 gcggccgcccgggcaggtaccta 287
>gb|AJ500301.1|AJ500301 AJ500301 MTGIM Medicago truncatula cDNA clone mtgmacc120014h08,
mRNA sequence
Length = 164
Score = 42.1 bits (21), Expect = 0.053
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtacc 21
|||||||||||||||||||||
Sbjct: 26 gcggccgcccgggcaggtacc 46
>gb|AJ548087.1|AJ548087 AJ548087 MTAPHEU Medicago truncatula cDNA clone mtaehac110005d06,
mRNA sequence
Length = 458
Score = 42.1 bits (21), Expect = 0.053
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 6 cgcccgggcaggtacctagta 26
|||||||||||||||||||||
Sbjct: 10 cgcccgggcaggtacctagta 30
>gb|AJ621860.1|AJ621860 AJ621860 Medicago truncatula J5 roots Medicago truncatula cDNA
clone MtGmEs470, mRNA sequence
Length = 1151
Score = 42.1 bits (21), Expect = 0.053
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtacc 21
|||||||||||||||||||||
Sbjct: 278 gcggccgcccgggcaggtacc 298
>gb|AW686764.1|AW686764 NF042E06NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF042E06NR 5', mRNA sequence
Length = 652
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 252 atggatggacctacttgcatgaaaggggtgaa 283
|||||||||||||| |||||||| || |||||
Sbjct: 411 atggatggacctacctgcatgaatggagtgaa 380
>gb|AJ500181.1|AJ500181 AJ500181 MTGIM Medicago truncatula cDNA clone mtgmacc120013f03,
mRNA sequence
Length = 614
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 223 gcggccgcccgggcaggtac 204
>gb|AJ500217.1|AJ500217 AJ500217 MTGIM Medicago truncatula cDNA clone mtgmacc120014a04,
mRNA sequence
Length = 458
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 319 gcggccgcccgggcaggtac 300
>gb|AJ500711.1|AJ500711 AJ500711 MTGIM Medicago truncatula cDNA clone mtgmacc120019d05,
mRNA sequence
Length = 591
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 320 gcggccgcccgggcaggtac 339
>gb|AJ864417.1|AJ864417 AJ864417 Medicago truncatula cv. J5 root Medicago truncatula cDNA
clone MtPfEs361, mRNA sequence
Length = 593
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 5 gcggccgcccgggcaggtac 24
>gb|AC147538.15| Medicago truncatula clone mth2-135c7, WORKING DRAFT SEQUENCE, 5 ordered
pieces
Length = 133186
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 252 atggatggacctacttgcatgaaaggggtgaa 283
|||||||||||||| |||||||| || |||||
Sbjct: 60257 atggatggacctacctgcatgaatggagtgaa 60288
>gb|AC147538.16| Medicago truncatula clone mth2-135c7, WORKING DRAFT SEQUENCE, 3 ordered
pieces
Length = 133436
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 252 atggatggacctacttgcatgaaaggggtgaa 283
|||||||||||||| |||||||| || |||||
Sbjct: 59989 atggatggacctacctgcatgaatggagtgaa 60020
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 106,645
Number of Sequences: 392609
Number of extensions: 106645
Number of successful extensions: 8551
Number of sequences better than 0.5: 15
Number of HSP's better than 0.5 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8526
Number of HSP's gapped (non-prelim): 25
length of query: 608
length of database: 441,732,993
effective HSP length: 19
effective length of query: 589
effective length of database: 434,273,422
effective search space: 255787045558
effective search space used: 255787045558
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)