BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBTB.006B01F020311.3.1
(609 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW689696.1|AW689696 NF023D01ST1F1000 Developing stem Med... 54 1e-005
gb|BF646871.1|BF646871 NF068B09EC1F1076 Elicited cell cultu... 54 1e-005
gb|BI308280.1|BI308280 EST529690 GPOD Medicago truncatula c... 52 6e-005
gb|BQ148260.1|BQ148260 NF065D12FL1F1102 Developing flower M... 52 6e-005
gb|CB891685.1|CB891685 EST648654 KV3 Medicago truncatula cD... 52 6e-005
gb|CB892038.1|CB892038 EST649007 KV3 Medicago truncatula cD... 52 6e-005
gb|CX535093.1|CX535093 s13dNF36H09MJ080_388365 Methyl Jasmo... 52 6e-005
gb|CX542040.1|CX542040 s13dNF89D01GS014_467388 Germinating ... 52 6e-005
gb|AJ498016.1|AJ498016 AJ498016 MTPOSE Medicago truncatula ... 48 9e-004
gb|AC141107.5| Medicago truncatula clone mth2-34a12, comple... 48 9e-004
>gb|AW689696.1|AW689696 NF023D01ST1F1000 Developing stem Medicago truncatula cDNA clone
NF023D01ST 5', mRNA sequence
Length = 634
Score = 54.0 bits (27), Expect = 1e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 430 ggtgttggcatttacaaccctggattctggggcatgaa 467
||||||||| |||| |||||||| ||||||||||||||
Sbjct: 554 ggtgttggcgtttataaccctggnttctggggcatgaa 591
>gb|BF646871.1|BF646871 NF068B09EC1F1076 Elicited cell culture Medicago truncatula cDNA
clone NF068B09EC 5', mRNA sequence
Length = 652
Score = 54.0 bits (27), Expect = 1e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 430 ggtgttggcatttacaaccctggattctggggcatgaa 467
||||||||| |||| |||||||| ||||||||||||||
Sbjct: 546 ggtgttggcgtttataaccctggnttctggggcatgaa 583
>gb|BI308280.1|BI308280 EST529690 GPOD Medicago truncatula cDNA clone pGPOD-2L19 5' end,
mRNA sequence
Length = 808
Score = 52.0 bits (26), Expect = 6e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 430 ggtgttggcatttacaaccctggattctggggcatgaa 467
||||||||| |||| |||||||| ||||||||||||||
Sbjct: 575 ggtgttggcgtttataaccctggtttctggggcatgaa 612
>gb|BQ148260.1|BQ148260 NF065D12FL1F1102 Developing flower Medicago truncatula cDNA clone
NF065D12FL 5', mRNA sequence
Length = 664
Score = 52.0 bits (26), Expect = 6e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 430 ggtgttggcatttacaaccctggattctggggcatgaa 467
||||||||| |||| |||||||| ||||||||||||||
Sbjct: 554 ggtgttggcgtttataaccctggtttctggggcatgaa 591
>gb|CB891685.1|CB891685 EST648654 KV3 Medicago truncatula cDNA clone KV3-51D17, mRNA
sequence
Length = 469
Score = 52.0 bits (26), Expect = 6e-005
Identities = 35/38 (92%)
Strand = Plus / Minus
Query: 430 ggtgttggcatttacaaccctggattctggggcatgaa 467
||||||||| |||| |||||||| ||||||||||||||
Sbjct: 198 ggtgttggcgtttataaccctggtttctggggcatgaa 161
>gb|CB892038.1|CB892038 EST649007 KV3 Medicago truncatula cDNA clone KV3-53A7, mRNA
sequence
Length = 569
Score = 52.0 bits (26), Expect = 6e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 430 ggtgttggcatttacaaccctggattctggggcatgaa 467
||||||||| |||| |||||||| ||||||||||||||
Sbjct: 166 ggtgttggcgtttataaccctggtttctggggcatgaa 203
>gb|CX535093.1|CX535093 s13dNF36H09MJ080_388365 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 505
Score = 52.0 bits (26), Expect = 6e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 430 ggtgttggcatttacaaccctggattctggggcatgaa 467
||||||||| |||| |||||||| ||||||||||||||
Sbjct: 195 ggtgttggcgtttataaccctggtttctggggcatgaa 232
>gb|CX542040.1|CX542040 s13dNF89D01GS014_467388 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 522
Score = 52.0 bits (26), Expect = 6e-005
Identities = 35/38 (92%)
Strand = Plus / Plus
Query: 430 ggtgttggcatttacaaccctggattctggggcatgaa 467
||||||||| |||| |||||||| ||||||||||||||
Sbjct: 179 ggtgttggcgtttataaccctggtttctggggcatgaa 216
>gb|AJ498016.1|AJ498016 AJ498016 MTPOSE Medicago truncatula cDNA clone mt--acc955200a10,
mRNA sequence
Length = 565
Score = 48.1 bits (24), Expect = 9e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 430 ggtgttggcatttacaaccctggattctggggcatg 465
||||||||| |||| |||||||| ||||||||||||
Sbjct: 427 ggtgttggcgtttataaccctggtttctggggcatg 462
>gb|AC141107.5| Medicago truncatula clone mth2-34a12, complete sequence
Length = 142659
Score = 48.1 bits (24), Expect = 9e-004
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 430 ggtgttggcatttacaaccctggattctggggcatg 465
||||||||| |||| |||||||| ||||||||||||
Sbjct: 55082 ggtgttggcgtttataaccctggtttctggggcatg 55117
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 93,973
Number of Sequences: 392609
Number of extensions: 93973
Number of successful extensions: 6625
Number of sequences better than 0.5: 10
Number of HSP's better than 0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 6600
Number of HSP's gapped (non-prelim): 25
length of query: 609
length of database: 441,732,993
effective HSP length: 19
effective length of query: 590
effective length of database: 434,273,422
effective search space: 256221318980
effective search space used: 256221318980
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)