BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBL17f07.xg.2.1
(657 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CG935467.1|CG935467 MBEFC81TR mth2 Medicago truncatula g... 40 0.23
gb|AC148397.13| Medicago truncatula clone mth2-22h4, comple... 40 0.23
gb|AC150978.15| Medicago truncatula clone mth2-66m17, compl... 40 0.23
>gb|CG935467.1|CG935467 MBEFC81TR mth2 Medicago truncatula genomic clone 42N17, DNA
sequence
Length = 492
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 298 tcgctgctgctgctgctgaa 317
||||||||||||||||||||
Sbjct: 416 tcgctgctgctgctgctgaa 397
>gb|AC148397.13| Medicago truncatula clone mth2-22h4, complete sequence
Length = 131213
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 298 tcgctgctgctgctgctgaa 317
||||||||||||||||||||
Sbjct: 7575 tcgctgctgctgctgctgaa 7556
>gb|AC150978.15| Medicago truncatula clone mth2-66m17, complete sequence
Length = 125121
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 298 tcgctgctgctgctgctgaa 317
||||||||||||||||||||
Sbjct: 108640 tcgctgctgctgctgctgaa 108621
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 91,175
Number of Sequences: 392609
Number of extensions: 91175
Number of successful extensions: 8885
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8873
Number of HSP's gapped (non-prelim): 6
length of query: 657
length of database: 441,732,993
effective HSP length: 19
effective length of query: 638
effective length of database: 434,273,422
effective search space: 277066443236
effective search space used: 277066443236
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)