BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAN24c09.yg.2.1
(425 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|CR338352.1| mte1-7H3RM1 BAC end, cultivar Jemalong A17 ... 76 3e-012
gb|DW015572.1|DW015572 EST1224533 MTY Medicago truncatula c... 76 3e-012
gb|AC148821.1| Medicago truncatula chromosome 2 clone mth2-... 76 3e-012
gb|AC137522.10| Medicago truncatula clone mth2-9h8, complet... 76 3e-012
gb|BG648585.1|BG648585 EST510204 HOGA Medicago truncatula c... 70 2e-010
gb|BI308076.1|BI308076 EST529486 GPOD Medicago truncatula c... 70 2e-010
gb|BI311236.1|BI311236 EST5312986 GESD Medicago truncatula ... 70 2e-010
gb|CA918394.1|CA918394 EST642541 GESD Medicago truncatula c... 70 2e-010
gb|CA919282.1|CA919282 EST637000 MTUS Medicago truncatula c... 70 2e-010
gb|CF068699.1|CF068699 EST669420 MTUS Medicago truncatula c... 70 2e-010
gb|CX541230.1|CX541230 s13dNF78H10GS092_465756 Germinating ... 70 2e-010
gb|AC149572.14| Medicago truncatula clone mth2-116e22, comp... 64 1e-008
emb|CT009508.6| M.truncatula DNA sequence from clone MTH2-7... 64 1e-008
gb|AY508218.1| Medicago truncatula chromosome 8 clone MtH25... 62 4e-008
gb|AC158373.1| Medicago truncatula chromosome 7 clone mte1-... 62 4e-008
emb|CT030158.4| M.truncatula DNA sequence from clone MTH2-4... 56 2e-006
gb|AW692037.2|AW692037 NF046H05ST1F1000 Developing stem Med... 54 1e-005
gb|BI311476.1|BI311476 EST5313226 GESD Medicago truncatula ... 54 1e-005
gb|BI312324.1|BI312324 EST5314074 GESD Medicago truncatula ... 54 1e-005
gb|CA917698.1|CA917698 EST641845 GPOD Medicago truncatula c... 54 1e-005
gb|CA918393.1|CA918393 EST642540 GESD Medicago truncatula c... 54 1e-005
gb|CA989884.1|CA989884 EST643392 GESD Medicago truncatula c... 54 1e-005
gb|CX542093.1|CX542093 s13dNF85A12GS097_467494 Germinating ... 54 1e-005
gb|AC150446.8| Medicago truncatula clone mth2-101n14, compl... 54 1e-005
gb|AC140546.11| Medicago truncatula clone mth2-35l19, compl... 54 1e-005
gb|BI311546.1|BI311546 EST5313296 GESD Medicago truncatula ... 48 6e-004
gb|DW016544.1|DW016544 EST1225505 MTY Medicago truncatula c... 48 6e-004
gb|AC131248.14| Medicago truncatula clone mth2-28n22, compl... 48 6e-004
gb|BG647010.1|BG647010 EST508629 HOGA Medicago truncatula c... 46 0.002
gb|BQ123644.1|BQ123644 EST609220 GLSD Medicago truncatula c... 46 0.002
gb|BQ147662.1|BQ147662 NF045A12FL1F1088 Developing flower M... 46 0.002
gb|BE203898.1|BE203898 EST396574 KV0 Medicago truncatula cD... 44 0.009
gb|AL368974.1|AL368974 MtBA28A12R1 MtBA Medicago truncatula... 44 0.009
gb|BF634582.1|BF634582 NF063B10DT1F1080 Drought Medicago tr... 44 0.009
gb|BG452180.1|BG452180 NF077E02LF1F1019 Developing leaf Med... 44 0.009
gb|BM779521.1|BM779521 EST590097 KV2 Medicago truncatula cD... 44 0.009
gb|BQ124574.1|BQ124574 EST610150 GLSD Medicago truncatula c... 44 0.009
gb|BQ139724.1|BQ139724 NF023F08PH1F1074 Phoma-infected Medi... 44 0.009
gb|CX541216.1|CX541216 s13dNF78E11GS087_465728 Germinating ... 44 0.009
gb|DW017499.1|DW017499 EST1226460 MTY Medicago truncatula c... 44 0.009
gb|AC150787.15| Medicago truncatula clone mth2-171n13, comp... 44 0.009
gb|CG932998.1|CG932998 MBEJA81TR mth2 Medicago truncatula g... 42 0.037
gb|AW560691.1|AW560691 EST315739 DSIR Medicago truncatula c... 42 0.037
gb|AC125473.12| Medicago truncatula clone mth2-8j13, comple... 42 0.037
gb|AC126014.6| Medicago truncatula clone mth2-18j5, complet... 42 0.037
gb|AC150978.15| Medicago truncatula clone mth2-66m17, compl... 42 0.037
>emb|CR338352.1| mte1-7H3RM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 614
Score = 75.8 bits (38), Expect = 3e-012
Identities = 56/62 (90%)
Strand = Plus / Minus
Query: 228 atggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggagg 287
|||| |||||||||| || |||||||||||||||||||| ||||| ||||| ||||||||
Sbjct: 165 atggggtggtgttggaatcgatgattggtggaggaatgaacagttttgggtgattggagg 106
Query: 288 tg 289
||
Sbjct: 105 tg 104
>gb|DW015572.1|DW015572 EST1224533 MTY Medicago truncatula cDNA clone MTYA701, mRNA
sequence
Length = 679
Score = 75.8 bits (38), Expect = 3e-012
Identities = 56/62 (90%)
Strand = Plus / Plus
Query: 228 atggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggagg 287
|||| |||||||||| || |||||||||||||||||||| ||||| ||||| ||||||||
Sbjct: 540 atggggtggtgttggaatcgatgattggtggaggaatgaacagttttgggtgattggagg 599
Query: 288 tg 289
||
Sbjct: 600 tg 601
>gb|AC148821.1| Medicago truncatula chromosome 2 clone mth2-80k8, *** SEQUENCING IN
PROGRESS ***, 2 ordered pieces
Length = 122271
Score = 75.8 bits (38), Expect = 3e-012
Identities = 56/62 (90%)
Strand = Plus / Plus
Query: 228 atggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggagg 287
|||| |||||||||| || |||||||||||||||||||| ||||| ||||| ||||||||
Sbjct: 111923 atggggtggtgttggaatcgatgattggtggaggaatgaacagttttgggtgattggagg 111982
Query: 288 tg 289
||
Sbjct: 111983 tg 111984
>gb|AC137522.10| Medicago truncatula clone mth2-9h8, complete sequence
Length = 117716
Score = 75.8 bits (38), Expect = 3e-012
Identities = 56/62 (90%)
Strand = Plus / Minus
Query: 228 atggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggagg 287
|||| |||||||||| || |||||||||||||||||||| ||||| ||||| ||||||||
Sbjct: 93780 atggggtggtgttggaatcgatgattggtggaggaatgaacagttttgggtgattggagg 93721
Query: 288 tg 289
||
Sbjct: 93720 tg 93719
>gb|BG648585.1|BG648585 EST510204 HOGA Medicago truncatula cDNA clone pHOGA-23O7 5' end,
mRNA sequence
Length = 788
Score = 69.9 bits (35), Expect = 2e-010
Identities = 62/71 (87%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
|||||||||||||||||||| |||||||| |||||||| || || ||||| ||||| ||
Sbjct: 193 atgagatggagtggtgttggaattgatgagtggtggagaaacgaacagttttgggttatc 252
Query: 283 ggaggtgtgtc 293
|| ||||||||
Sbjct: 253 ggtggtgtgtc 263
>gb|BI308076.1|BI308076 EST529486 GPOD Medicago truncatula cDNA clone pGPOD-2E17 5' end,
mRNA sequence
Length = 764
Score = 69.9 bits (35), Expect = 2e-010
Identities = 62/71 (87%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
|||||||||||||||||||| |||||||| |||||||| || || ||||| ||||| ||
Sbjct: 488 atgagatggagtggtgttggaattgatgagtggtggagaaacgaacagttttgggttatc 547
Query: 283 ggaggtgtgtc 293
|| ||||||||
Sbjct: 548 ggtggtgtgtc 558
>gb|BI311236.1|BI311236 EST5312986 GESD Medicago truncatula cDNA clone pGESD10E22 5' end,
mRNA sequence
Length = 807
Score = 69.9 bits (35), Expect = 2e-010
Identities = 62/71 (87%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
|||||||||||||||||||| |||||||| |||||||| || || ||||| ||||| ||
Sbjct: 448 atgagatggagtggtgttggaattgatgagtggtggagaaacgaacagttttgggttatc 507
Query: 283 ggaggtgtgtc 293
|| ||||||||
Sbjct: 508 ggtggtgtgtc 518
>gb|CA918394.1|CA918394 EST642541 GESD Medicago truncatula cDNA clone GESD-21C15, mRNA
sequence
Length = 830
Score = 69.9 bits (35), Expect = 2e-010
Identities = 62/71 (87%)
Strand = Plus / Minus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
|||||||||||||||||||| |||||||| |||||||| || || ||||| ||||| ||
Sbjct: 692 atgagatggagtggtgttggaattgatgagtggtggagaaacgaacagttttgggttatc 633
Query: 283 ggaggtgtgtc 293
|| ||||||||
Sbjct: 632 ggtggtgtgtc 622
>gb|CA919282.1|CA919282 EST637000 MTUS Medicago truncatula cDNA clone MTUS-11D5, mRNA
sequence
Length = 735
Score = 69.9 bits (35), Expect = 2e-010
Identities = 62/71 (87%)
Strand = Plus / Minus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
|||||||||||||||||||| |||||||| |||||||| || || ||||| ||||| ||
Sbjct: 671 atgagatggagtggtgttggaattgatgagtggtggagaaacgaacagttttgggttatc 612
Query: 283 ggaggtgtgtc 293
|| ||||||||
Sbjct: 611 ggtggtgtgtc 601
>gb|CF068699.1|CF068699 EST669420 MTUS Medicago truncatula cDNA clone MTUS-11D5, mRNA
sequence
Length = 589
Score = 69.9 bits (35), Expect = 2e-010
Identities = 62/71 (87%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
|||||||||||||||||||| |||||||| |||||||| || || ||||| ||||| ||
Sbjct: 418 atgagatggagtggtgttggaattgatgagtggtggagaaacgaacagttttgggttatc 477
Query: 283 ggaggtgtgtc 293
|| ||||||||
Sbjct: 478 ggtggtgtgtc 488
>gb|CX541230.1|CX541230 s13dNF78H10GS092_465756 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 642
Score = 69.9 bits (35), Expect = 2e-010
Identities = 62/71 (87%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
|||||||||||||||||||| |||||||| |||||||| || || ||||| ||||| ||
Sbjct: 203 atgagatggagtggtgttggaattgatgagtggtggagaaacgaacagttttgggttatc 262
Query: 283 ggaggtgtgtc 293
|| ||||||||
Sbjct: 263 ggtggtgtgtc 273
>gb|AC149572.14| Medicago truncatula clone mth2-116e22, complete sequence
Length = 120017
Score = 63.9 bits (32), Expect = 1e-008
Identities = 59/68 (86%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| |||||||| |||||||| ||||| || || ||||| |||
Sbjct: 93334 atgaggtggagtggtgttggaattgatgaatggtggagaaatgaacaattttgggttatt 93393
Query: 283 ggaggtgt 290
|| |||||
Sbjct: 93394 ggtggtgt 93401
>emb|CT009508.6| M.truncatula DNA sequence from clone MTH2-76H16 on chromosome 3, complete
sequence
Length = 133910
Score = 63.9 bits (32), Expect = 1e-008
Identities = 59/68 (86%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||||||||| |||||||| |||||||| ||||| || || ||||| |||
Sbjct: 129312 atgaggtggagtggtgttggaattgatgaatggtggagaaatgaacaattttgggttatt 129371
Query: 283 ggaggtgt 290
|| |||||
Sbjct: 129372 ggtggtgt 129379
>gb|AY508218.1| Medicago truncatula chromosome 8 clone MtH259A18, *** SEQUENCING IN
PROGRESS ***, 3 ordered pieces
Length = 137989
Score = 61.9 bits (31), Expect = 4e-008
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
|||||||||||||||||||| || | || |||||||| ||||| || || |||||||||
Sbjct: 62379 atgagatggagtggtgttggaatccacgagtggtggagaaatgaacaattttgggtcatt 62320
Query: 283 ggaggtgtgtc 293
|| ||||||||
Sbjct: 62319 gggggtgtgtc 62309
>gb|AC158373.1| Medicago truncatula chromosome 7 clone mte1-55d18, *** SEQUENCING IN
PROGRESS ***, 2 unordered pieces
Length = 126006
Score = 61.9 bits (31), Expect = 4e-008
Identities = 61/71 (85%)
Strand = Plus / Minus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
|||||||||||||||||||| || | || |||||||| ||||| || || |||||||||
Sbjct: 83906 atgagatggagtggtgttggaatccacgagtggtggagaaatgaacaattttgggtcatt 83847
Query: 283 ggaggtgtgtc 293
|| ||||||||
Sbjct: 83846 gggggtgtgtc 83836
>emb|CT030158.4| M.truncatula DNA sequence from clone MTH2-49E10 on chromosome 3,
complete sequence
Length = 122591
Score = 56.0 bits (28), Expect = 2e-006
Identities = 58/68 (85%)
Strand = Plus / Plus
Query: 223 atgagatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcatt 282
||||| |||||||| ||| |||||||| |||||||| |||||||| || ||||| |||
Sbjct: 40052 atgaggtggagtggagttacaattgatgaatggtggagaaatgagcaattttgggtaatt 40111
Query: 283 ggaggtgt 290
||||||||
Sbjct: 40112 ggaggtgt 40119
>gb|AW692037.2|AW692037 NF046H05ST1F1000 Developing stem Medicago truncatula cDNA clone
NF046H05ST 5', mRNA sequence
Length = 592
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 244 attgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| || |||||||| |||||||| |||||||||||||| |||||
Sbjct: 63 attgaggaatggtggagaaatgagcaattctgggtcattggtggtgt 109
>gb|BI311476.1|BI311476 EST5313226 GESD Medicago truncatula cDNA clone pGESD13A7 5' end,
mRNA sequence
Length = 842
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 244 attgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| || |||||||| |||||||| |||||||||||||| |||||
Sbjct: 364 attgaggaatggtggagaaatgagcaattctgggtcattggtggtgt 410
>gb|BI312324.1|BI312324 EST5314074 GESD Medicago truncatula cDNA clone pGESD17P11 5' end,
mRNA sequence
Length = 711
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 244 attgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| || |||||||| |||||||| |||||||||||||| |||||
Sbjct: 222 attgaggaatggtggagaaatgagcaattctgggtcattggtggtgt 268
>gb|CA917698.1|CA917698 EST641845 GPOD Medicago truncatula cDNA clone GPOD-37A21, mRNA
sequence
Length = 830
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 244 attgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| || |||||||| |||||||| |||||||||||||| |||||
Sbjct: 627 attgaggaatggtggagaaatgagcaattctgggtcattggtggtgt 673
>gb|CA918393.1|CA918393 EST642540 GESD Medicago truncatula cDNA clone GESD-21C15, mRNA
sequence
Length = 807
Score = 54.0 bits (27), Expect = 1e-005
Identities = 63/74 (85%), Gaps = 2/74 (2%)
Strand = Plus / Plus
Query: 222 aatgagatggagtggtgttgggattgatga--ttggtggaggaatgagcagttctgggtc 279
||||||||||||||||||||| |||||||| | ||||||| || || ||||| |||||
Sbjct: 400 aatgagatggagtggtgttggaattgatgaattgggtggagaaacgaacagttttgggtt 459
Query: 280 attggaggtgtgtc 293
|| || ||||||||
Sbjct: 460 atcggtggtgtgtc 473
>gb|CA989884.1|CA989884 EST643392 GESD Medicago truncatula cDNA clone GESD-21H19, mRNA
sequence
Length = 842
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 244 attgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| || |||||||| |||||||| |||||||||||||| |||||
Sbjct: 157 attgaggaatggtggagaaatgagcaattctgggtcattggtggtgt 203
>gb|CX542093.1|CX542093 s13dNF85A12GS097_467494 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 617
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 244 attgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| || |||||||| |||||||| |||||||||||||| |||||
Sbjct: 140 attgaggaatggtggagaaatgagcaattctgggtcattggtggtgt 186
>gb|AC150446.8| Medicago truncatula clone mth2-101n14, complete sequence
Length = 109162
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 244 attgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| || |||||||| |||||||| |||||||||||||| |||||
Sbjct: 106737 attgaggaatggtggagaaatgagcaattctgggtcattggtggtgt 106783
>gb|AC140546.11| Medicago truncatula clone mth2-35l19, complete sequence
Length = 106963
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 244 attgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| || |||||||| |||||||| |||||||||||||| |||||
Sbjct: 30950 attgaggaatggtggagaaatgagcaattctgggtcattggtggtgt 30996
>gb|BI311546.1|BI311546 EST5313296 GESD Medicago truncatula cDNA clone pGESD13M17 5' end,
mRNA sequence
Length = 811
Score = 48.1 bits (24), Expect = 6e-004
Identities = 54/64 (84%)
Strand = Plus / Plus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggag 286
|||||||||| |||| || || || |||||||| || ||||| |||||||| |||||||
Sbjct: 148 gatggagtggagttgccatcgaagactggtggagaaacgagcaattctgggttattggag 207
Query: 287 gtgt 290
||||
Sbjct: 208 gtgt 211
>gb|DW016544.1|DW016544 EST1225505 MTY Medicago truncatula cDNA clone MTYAI54, mRNA
sequence
Length = 787
Score = 48.1 bits (24), Expect = 6e-004
Identities = 54/64 (84%)
Strand = Plus / Plus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggag 286
|||||||||| |||| || || || |||||||| || ||||| |||||||| |||||||
Sbjct: 217 gatggagtggagttgccatcgaagactggtggagaaacgagcaattctgggttattggag 276
Query: 287 gtgt 290
||||
Sbjct: 277 gtgt 280
>gb|AC131248.14| Medicago truncatula clone mth2-28n22, complete sequence
Length = 136333
Score = 48.1 bits (24), Expect = 6e-004
Identities = 54/64 (84%)
Strand = Plus / Minus
Query: 227 gatggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggag 286
|||||||||| |||| || || || |||||||| || ||||| |||||||| |||||||
Sbjct: 100080 gatggagtggagttgccatcgaagactggtggagaaacgagcaattctgggttattggag 100021
Query: 287 gtgt 290
||||
Sbjct: 100020 gtgt 100017
>gb|BG647010.1|BG647010 EST508629 HOGA Medicago truncatula cDNA clone pHOGA-15M12 5' end,
mRNA sequence
Length = 727
Score = 46.1 bits (23), Expect = 0.002
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 244 attgatgattggtggaggaatgagcagttctgggtcattggaggtgt 290
||||| || |||||||| ||||||| |||||||||||||| |||||
Sbjct: 669 attgaggaatggtggagaaatgagccattctgggtcattggtggtgt 715
>gb|BQ123644.1|BQ123644 EST609220 GLSD Medicago truncatula cDNA clone pGLSD-32N16, mRNA
sequence
Length = 579
Score = 46.1 bits (23), Expect = 0.002
Identities = 50/59 (84%)
Strand = Plus / Plus
Query: 229 tggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggagg 287
|||||||||||||| || || || |||||||| || |||||||| ||||| || |||||
Sbjct: 175 tggagtggtgttggtatagaagactggtggagaaacgagcagttttgggttatcggagg 233
>gb|BQ147662.1|BQ147662 NF045A12FL1F1088 Developing flower Medicago truncatula cDNA clone
NF045A12FL 5', mRNA sequence
Length = 698
Score = 46.1 bits (23), Expect = 0.002
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 229 tggagtggtgttgggattgatgattggtgga 259
|||||||||||||| |||||||| |||||||
Sbjct: 613 tggagtggtgttggaattgatgaatggtgga 643
>gb|BE203898.1|BE203898 EST396574 KV0 Medicago truncatula cDNA clone pKV0-13K7, mRNA
sequence
Length = 611
Score = 44.1 bits (22), Expect = 0.009
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 229 tggagtggtgttgggattgatgattggtggaggaatgagcagttctgggt 278
|||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 178 tggagtggtgttggtatagaagactggtggagaaacgagcagttttgggt 227
>gb|AL368974.1|AL368974 MtBA28A12R1 MtBA Medicago truncatula cDNA clone MtBA28A12 T7, mRNA
sequence
Length = 449
Score = 44.1 bits (22), Expect = 0.009
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 229 tggagtggtgttgggattgatgattggtggaggaatgagcagttctgggt 278
|||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 326 tggagtggtgttggtatagaagactggtggagaaacgagcagttttgggt 277
>gb|BF634582.1|BF634582 NF063B10DT1F1080 Drought Medicago truncatula cDNA clone NF063B10DT
5', mRNA sequence
Length = 682
Score = 44.1 bits (22), Expect = 0.009
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 229 tggagtggtgttgggattgatgattggtggaggaatgagcagttctgggt 278
|||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 459 tggagtggtgttggtatagaagactggtggagaaacgagcagttttgggt 508
>gb|BG452180.1|BG452180 NF077E02LF1F1019 Developing leaf Medicago truncatula cDNA clone
NF077E02LF 5', mRNA sequence
Length = 586
Score = 44.1 bits (22), Expect = 0.009
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 265 gagcagttctgggtcattggaggtgt 290
||||| ||||||||||||||||||||
Sbjct: 326 gagcaattctgggtcattggaggtgt 351
>gb|BM779521.1|BM779521 EST590097 KV2 Medicago truncatula cDNA clone pKV2-52A8, mRNA
sequence
Length = 569
Score = 44.1 bits (22), Expect = 0.009
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 229 tggagtggtgttgggattgatgattggtggaggaatgagcagttctgggt 278
|||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 200 tggagtggtgttggtatagaagactggtggagaaacgagcagttttgggt 249
>gb|BQ124574.1|BQ124574 EST610150 GLSD Medicago truncatula cDNA clone pGLSD-35N3, mRNA
sequence
Length = 586
Score = 44.1 bits (22), Expect = 0.009
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 229 tggagtggtgttgggattgatgattggtggaggaatgagcagttctgggt 278
|||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 187 tggagtggtgttggtatagaagactggtggagaaacgagcagttttgggt 236
>gb|BQ139724.1|BQ139724 NF023F08PH1F1074 Phoma-infected Medicago truncatula cDNA clone
NF023F08PH 5', mRNA sequence
Length = 663
Score = 44.1 bits (22), Expect = 0.009
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 229 tggagtggtgttgggattgatgattggtggaggaatgagcagttctgggt 278
|||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 210 tggagtggtgttggtatagaagactggtggagaaacgagcagttttgggt 259
>gb|CX541216.1|CX541216 s13dNF78E11GS087_465728 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 611
Score = 44.1 bits (22), Expect = 0.009
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 229 tggagtggtgttgggattgatgattggtggaggaatgagcagttctgggt 278
|||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 181 tggagtggtgttggtatagaagactggtggagaaacgagcagttttgggt 230
>gb|DW017499.1|DW017499 EST1226460 MTY Medicago truncatula cDNA clone MTYAU40, mRNA
sequence
Length = 769
Score = 44.1 bits (22), Expect = 0.009
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 229 tggagtggtgttgggattgatgattggtggaggaatgagcagttctgggt 278
|||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 630 tggagtggtgttggtatagaagactggtggagaaacgagcagttttgggt 679
>gb|AC150787.15| Medicago truncatula clone mth2-171n13, complete sequence
Length = 82665
Score = 44.1 bits (22), Expect = 0.009
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 229 tggagtggtgttgggattgatgattggtggaggaatgagcagttctgggt 278
|||||||||||||| || || || |||||||| || |||||||| |||||
Sbjct: 49070 tggagtggtgttggtatagaagactggtggagaaacgagcagttttgggt 49021
>gb|CG932998.1|CG932998 MBEJA81TR mth2 Medicago truncatula genomic clone 66M17, DNA
sequence
Length = 921
Score = 42.1 bits (21), Expect = 0.037
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcat 281
|||||||||||||| || |||||||||||
Sbjct: 874 tggtggaggaatgaacaattctgggtcat 902
>gb|AW560691.1|AW560691 EST315739 DSIR Medicago truncatula cDNA clone pDSIR-28C1, mRNA
sequence
Length = 421
Score = 42.1 bits (21), Expect = 0.037
Identities = 36/41 (87%)
Strand = Plus / Plus
Query: 244 attgatgattggtggaggaatgagcagttctgggtcattgg 284
||||| || |||||||| |||||||| |||||||||||||
Sbjct: 378 attgaggaatggtggagaaatgagcaaatctgggtcattgg 418
>gb|AC125473.12| Medicago truncatula clone mth2-8j13, complete sequence
Length = 103966
Score = 42.1 bits (21), Expect = 0.037
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 253 tggtggaggaatgagcagttctgggtcat 281
|||||||||||||| || |||||||||||
Sbjct: 8485 tggtggaggaatgaacaattctgggtcat 8457
>gb|AC126014.6| Medicago truncatula clone mth2-18j5, complete sequence
Length = 113200
Score = 42.1 bits (21), Expect = 0.037
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcat 281
|||||||||||||| || |||||||||||
Sbjct: 91154 tggtggaggaatgaacaattctgggtcat 91182
>gb|AC150978.15| Medicago truncatula clone mth2-66m17, complete sequence
Length = 125121
Score = 42.1 bits (21), Expect = 0.037
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 253 tggtggaggaatgagcagttctgggtcat 281
|||||||||||||| || |||||||||||
Sbjct: 874 tggtggaggaatgaacaattctgggtcat 902
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 157,496
Number of Sequences: 392609
Number of extensions: 157496
Number of successful extensions: 12393
Number of sequences better than 0.5: 46
Number of HSP's better than 0.5 without gapping: 46
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12297
Number of HSP's gapped (non-prelim): 96
length of query: 425
length of database: 441,732,993
effective HSP length: 19
effective length of query: 406
effective length of database: 434,273,422
effective search space: 176315009332
effective search space used: 176315009332
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)