BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QAH4a02.xg.2.1
         (526 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC161401.2|  Medicago truncatula chromosome 7 clone mte1-...    46   0.003
gb|AC141107.5|  Medicago truncatula clone mth2-34a12, comple...    40   0.18 

>gb|AC161401.2| Medicago truncatula chromosome 7 clone mte1-59b16, *** SEQUENCING IN
             PROGRESS ***, 2 ordered pieces
          Length = 95675

 Score = 46.1 bits (23), Expect = 0.003
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 25    gctgaagctgcatttctcattgg 47
             |||||||||||||||||||||||
Sbjct: 46859 gctgaagctgcatttctcattgg 46881




 Score = 46.1 bits (23), Expect = 0.003
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 25   gctgaagctgcatttctcattgg 47
            |||||||||||||||||||||||
Sbjct: 7571 gctgaagctgcatttctcattgg 7593




 Score = 46.1 bits (23), Expect = 0.003
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 25   gctgaagctgcatttctcattgg 47
            |||||||||||||||||||||||
Sbjct: 1074 gctgaagctgcatttctcattgg 1096



>gb|AC141107.5| Medicago truncatula clone mth2-34a12, complete sequence
          Length = 142659

 Score = 40.1 bits (20), Expect = 0.18
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 25    gctgaagctgcatttctcattggattagaaag 56
             |||||||||| ||| || ||||||||||||||
Sbjct: 65180 gctgaagctggattccttattggattagaaag 65211



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 133,938
Number of Sequences: 392609
Number of extensions: 133938
Number of successful extensions: 8761
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8749
Number of HSP's gapped (non-prelim): 12
length of query: 526
length of database: 441,732,993
effective HSP length: 19
effective length of query: 507
effective length of database: 434,273,422
effective search space: 220176624954
effective search space used: 220176624954
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)