BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAF30a10.yg.2.1
(1130 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BF645935.1|BF645935 NF042H03EC1F1031 Elicited cell cultu... 54 3e-005
gb|AC159143.4| Medicago truncatula chromosome 2 clone mth2-... 54 3e-005
emb|CR325153.1| mte1-52H15FM1 BAC end, cultivar Jemalong A1... 46 0.006
emb|CR336376.1| mte1-67K24RM1 BAC end, cultivar Jemalong A1... 46 0.006
emb|CR295204.1| mte1-11K22RM1 BAC end, cultivar Jemalong A1... 46 0.006
gb|CG953814.1|CG953814 MBEHT59TR mth2 Medicago truncatula g... 44 0.025
gb|AL375656.1|AL375656 MtBB16B06F1 MtBB Medicago truncatula... 44 0.025
gb|BI311090.1|BI311090 EST5312840 GESD Medicago truncatula ... 44 0.025
gb|AC141922.19| Medicago truncatula clone mth2-9n11, comple... 44 0.025
gb|AC142094.12| Medicago truncatula clone mth2-34h6, comple... 44 0.025
gb|AC170800.5| Medicago truncatula clone mth2-32n7, complet... 44 0.025
gb|AC144931.28| Medicago truncatula clone mth2-22b18, compl... 44 0.025
gb|AZ773484.1|AZ773484 T221268b Ser/Thr kinase-like sequenc... 42 0.10
gb|CG936422.1|CG936422 MBEME66TR mth2 Medicago truncatula g... 42 0.10
gb|CG956051.1|CG956051 MBEHC40TR mth2 Medicago truncatula g... 42 0.10
emb|CR486349.1| mth2-155P21FM2 BAC end, cultivar Jemalong A... 42 0.10
emb|CR305928.1| mte1-26A9RM1 BAC end, cultivar Jemalong A17... 42 0.10
gb|BE940834.1|BE940834 EST420413 MGHG Medicago truncatula c... 42 0.10
gb|BE323683.2|BE323683 NF005B03PL1F1025 Phosphate starved l... 42 0.10
gb|BG645570.1|BG645570 EST507189 KV3 Medicago truncatula cD... 42 0.10
gb|BG648089.1|BG648089 EST509708 HOGA Medicago truncatula c... 42 0.10
gb|BI264000.1|BI264000 NF110D08PL1F1074 Phosphate starved l... 42 0.10
gb|BI268120.1|BI268120 NF116D10IN1F1090 Insect herbivory Me... 42 0.10
gb|BI309753.1|BI309753 EST5311491 GESD Medicago truncatula ... 42 0.10
gb|BI311462.1|BI311462 EST5313212 GESD Medicago truncatula ... 42 0.10
gb|BQ136505.1|BQ136505 NF081D09EC1F1076 Elicited cell cultu... 42 0.10
gb|BQ138136.1|BQ138136 NF037C10PH1F1082 Phoma-infected Medi... 42 0.10
gb|BQ149140.1|BQ149140 NF088B07FL1F1061 Developing flower M... 42 0.10
gb|BQ149220.1|BQ149220 NF088E12FL1F1099 Developing flower M... 42 0.10
gb|BQ149240.1|BQ149240 NF088E12FL1F1098 Developing flower M... 42 0.10
gb|CB891649.1|CB891649 EST648618 KV3 Medicago truncatula cD... 42 0.10
gb|CX529496.1|CX529496 s13dNF94H02MJ016_245043 Methyl Jasmo... 42 0.10
gb|DW015529.1|DW015529 EST1224490 MTY Medicago truncatula c... 42 0.10
gb|AC135230.8| Medicago truncatula clone mth2-23e14, comple... 42 0.10
gb|AC137829.23| Medicago truncatula clone mth2-34j5, comple... 42 0.10
emb|CR955004.2| Medicago truncatula chromosome 5 clone mte1... 42 0.10
gb|AC141862.44| Medicago truncatula clone mth2-33n1, WORKIN... 42 0.10
emb|CR317899.1| mte1-42P5FM1 BAC end, cultivar Jemalong A17... 40 0.40
gb|AW686315.2|AW686315 NF036E06NR1F1000 Nodulated root Medi... 40 0.40
gb|BG645280.1|BG645280 EST506899 KV3 Medicago truncatula cD... 40 0.40
gb|CX532361.1|CX532361 s13dNF60G12MJ088_271016 Methyl Jasmo... 40 0.40
gb|AC146343.18| Medicago truncatula clone mth2-11a24, WORKI... 40 0.40
emb|CT573354.1| Medicago truncatula chromosome 3 clone MTH2... 40 0.40
>gb|BF645935.1|BF645935 NF042H03EC1F1031 Elicited cell culture Medicago truncatula cDNA
clone NF042H03EC 5', mRNA sequence
Length = 584
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 648 gtgcatagggacataaaggccagcaatgtattacttgat 686
|||||||||||||| ||||| |||||||| |||||||||
Sbjct: 466 gtgcatagggacattaaggcaagcaatgttttacttgat 504
>gb|AC159143.4| Medicago truncatula chromosome 2 clone mth2-154m16, *** SEQUENCING IN
PROGRESS ***, 3 ordered pieces
Length = 119326
Score = 54.0 bits (27), Expect = 3e-005
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 648 gtgcatagggacataaaggccagcaatgtattacttgat 686
|||||||||||||| ||||| |||||||| |||||||||
Sbjct: 53631 gtgcatagggacattaaggcaagcaatgttttacttgat 53669
>emb|CR325153.1| mte1-52H15FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 746
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 303 cttggtgaagggggatatggatcagtttataaggg 337
|||||||||||||||| |||| | |||||||||||
Sbjct: 459 cttggtgaagggggatttggaactgtttataaggg 493
>emb|CR336376.1| mte1-67K24RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 742
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 303 cttggtgaagggggatatggatcagtttataaggg 337
|||||||||||||||| |||| | |||||||||||
Sbjct: 258 cttggtgaagggggatttggaactgtttataaggg 292
>emb|CR295204.1| mte1-11K22RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 490
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 303 cttggtgaagggggatatggatcagtttataaggg 337
|||||||||||||||| |||| | |||||||||||
Sbjct: 258 cttggtgaagggggatttggaactgtttataaggg 292
>gb|CG953814.1|CG953814 MBEHT59TR mth2 Medicago truncatula genomic clone 58J22, DNA
sequence
Length = 903
Score = 44.1 bits (22), Expect = 0.025
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 494 acttttggtttatgagtacatg 515
||||||||||||||||||||||
Sbjct: 511 acttttggtttatgagtacatg 490
>gb|AL375656.1|AL375656 MtBB16B06F1 MtBB Medicago truncatula cDNA clone MtBB16B06 T3, mRNA
sequence
Length = 482
Score = 44.1 bits (22), Expect = 0.025
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 651 catagggacataaaggccagcaatgt 676
||||| ||||||||||||||||||||
Sbjct: 12 catagagacataaaggccagcaatgt 37
>gb|BI311090.1|BI311090 EST5312840 GESD Medicago truncatula cDNA clone pGESD9L20 5' end,
mRNA sequence
Length = 604
Score = 44.1 bits (22), Expect = 0.025
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 494 acttttggtttatgagtacatg 515
||||||||||||||||||||||
Sbjct: 65 acttttggtttatgagtacatg 86
>gb|AC141922.19| Medicago truncatula clone mth2-9n11, complete sequence
Length = 107448
Score = 44.1 bits (22), Expect = 0.025
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 494 acttttggtttatgagtacatg 515
||||||||||||||||||||||
Sbjct: 75793 acttttggtttatgagtacatg 75814
>gb|AC142094.12| Medicago truncatula clone mth2-34h6, complete sequence
Length = 151594
Score = 44.1 bits (22), Expect = 0.025
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 494 acttttggtttatgagtacatg 515
||||||||||||||||||||||
Sbjct: 104266 acttttggtttatgagtacatg 104245
>gb|AC170800.5| Medicago truncatula clone mth2-32n7, complete sequence
Length = 99712
Score = 44.1 bits (22), Expect = 0.025
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 494 acttttggtttatgagtacatg 515
||||||||||||||||||||||
Sbjct: 65312 acttttggtttatgagtacatg 65333
>gb|AC144931.28| Medicago truncatula clone mth2-22b18, complete sequence
Length = 122821
Score = 44.1 bits (22), Expect = 0.025
Identities = 22/22 (100%)
Strand = Plus / Plus
Query: 494 acttttggtttatgagtacatg 515
||||||||||||||||||||||
Sbjct: 47330 acttttggtttatgagtacatg 47351
>gb|AZ773484.1|AZ773484 T221268b Ser/Thr kinase-like sequences from Medicago truncatula
Medicago truncatula genomic clone K-A3, DNA sequence
Length = 537
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 496 ttttggtttatgagtacatgg 516
|||||||||||||||||||||
Sbjct: 182 ttttggtttatgagtacatgg 202
>gb|CG936422.1|CG936422 MBEME66TR mth2 Medicago truncatula genomic clone 1K11, DNA sequence
Length = 898
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 712 cttttggtttatgagtacatg 732
>gb|CG956051.1|CG956051 MBEHC40TR mth2 Medicago truncatula genomic clone 54H7, DNA sequence
Length = 932
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 370 cttttggtttatgagtacatg 390
>emb|CR486349.1| mth2-155P21FM2 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 710
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 375 cttttggtttatgagtacatg 395
>emb|CR305928.1| mte1-26A9RM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 677
Score = 42.1 bits (21), Expect = 0.10
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 829 ttgatatttttgcttttggtgtggt 853
||||||| |||||||||||||||||
Sbjct: 151 ttgatatatttgcttttggtgtggt 175
>gb|BE940834.1|BE940834 EST420413 MGHG Medicago truncatula cDNA clone pMGHG-2C5, mRNA
sequence
Length = 632
Score = 42.1 bits (21), Expect = 0.10
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 528 cttgataaagcattgtttggaaatg 552
|||||| ||||||||||||||||||
Sbjct: 161 cttgatcaagcattgtttggaaatg 185
>gb|BE323683.2|BE323683 NF005B03PL1F1025 Phosphate starved leaf Medicago truncatula cDNA
clone NF005B03PL 5', mRNA sequence
Length = 406
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 271 cttttggtttatgagtacatg 291
>gb|BG645570.1|BG645570 EST507189 KV3 Medicago truncatula cDNA clone pKV3-46N17 5' end,
mRNA sequence
Length = 800
Score = 42.1 bits (21), Expect = 0.10
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 528 cttgataaagcattgtttggaaatg 552
|||||| ||||||||||||||||||
Sbjct: 146 cttgatcaagcattgtttggaaatg 170
>gb|BG648089.1|BG648089 EST509708 HOGA Medicago truncatula cDNA clone pHOGA-18D24 5' end,
mRNA sequence
Length = 515
Score = 42.1 bits (21), Expect = 0.10
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 528 cttgataaagcattgtttggaaatg 552
|||||| ||||||||||||||||||
Sbjct: 346 cttgatcaagcattgtttggaaatg 370
>gb|BI264000.1|BI264000 NF110D08PL1F1074 Phosphate starved leaf Medicago truncatula cDNA
clone NF110D08PL 5', mRNA sequence
Length = 646
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 593 cttttggtttatgagtacatg 613
>gb|BI268120.1|BI268120 NF116D10IN1F1090 Insect herbivory Medicago truncatula cDNA clone
NF116D10IN 5', mRNA sequence
Length = 622
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 561 cttttggtttatgagtacatg 581
>gb|BI309753.1|BI309753 EST5311491 GESD Medicago truncatula cDNA clone pGESD4A9 5' end,
mRNA sequence
Length = 652
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 765 gttgctggtacatttggctat 785
|||||||||||||||||||||
Sbjct: 121 gttgctggtacatttggctat 141
>gb|BI311462.1|BI311462 EST5313212 GESD Medicago truncatula cDNA clone pGESD10P2 5' end,
mRNA sequence
Length = 772
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 544 cttttggtttatgagtacatg 564
>gb|BQ136505.1|BQ136505 NF081D09EC1F1076 Elicited cell culture Medicago truncatula cDNA
clone NF081D09EC 5', mRNA sequence
Length = 728
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 441 cagcaccgtaatcttgtgaag 461
|||||||||||||||||||||
Sbjct: 220 cagcaccgtaatcttgtgaag 240
>gb|BQ138136.1|BQ138136 NF037C10PH1F1082 Phoma-infected Medicago truncatula cDNA clone
NF037C10PH 5', mRNA sequence
Length = 296
Score = 42.1 bits (21), Expect = 0.10
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 528 cttgataaagcattgtttggaaatg 552
|||||| ||||||||||||||||||
Sbjct: 214 cttgatcaagcattgtttggaaatg 238
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 438 gtgcagcaccgtaatcttgt 457
||||||||||||||||||||
Sbjct: 124 gtgcagcaccgtaatcttgt 143
>gb|BQ149140.1|BQ149140 NF088B07FL1F1061 Developing flower Medicago truncatula cDNA clone
NF088B07FL 5', mRNA sequence
Length = 645
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 593 cttttggtttatgagtacatg 613
>gb|BQ149220.1|BQ149220 NF088E12FL1F1099 Developing flower Medicago truncatula cDNA clone
NF088E12FL 5', mRNA sequence
Length = 637
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 440 cttttggtttatgagtacatg 460
>gb|BQ149240.1|BQ149240 NF088E12FL1F1098 Developing flower Medicago truncatula cDNA clone
NF088E12FL 5', mRNA sequence
Length = 693
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 440 cttttggtttatgagtacatg 460
>gb|CB891649.1|CB891649 EST648618 KV3 Medicago truncatula cDNA clone KV3-51E24, mRNA
sequence
Length = 789
Score = 42.1 bits (21), Expect = 0.10
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 528 cttgataaagcattgtttggaaatg 552
|||||| ||||||||||||||||||
Sbjct: 657 cttgatcaagcattgtttggaaatg 681
>gb|CX529496.1|CX529496 s13dNF94H02MJ016_245043 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 644
Score = 42.1 bits (21), Expect = 0.10
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 528 cttgataaagcattgtttggaaatg 552
|||||| ||||||||||||||||||
Sbjct: 325 cttgatcaagcattgtttggaaatg 349
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 438 gtgcagcaccgtaatcttgt 457
||||||||||||||||||||
Sbjct: 235 gtgcagcaccgtaatcttgt 254
>gb|DW015529.1|DW015529 EST1224490 MTY Medicago truncatula cDNA clone MTYA639, mRNA
sequence
Length = 905
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 637 cttttggtttatgagtacatg 657
>gb|AC135230.8| Medicago truncatula clone mth2-23e14, complete sequence
Length = 124972
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 80801 cttttggtttatgagtacatg 80821
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 70940 cttttggtttatgagtacatg 70960
>gb|AC137829.23| Medicago truncatula clone mth2-34j5, complete sequence
Length = 127295
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 55541 cttttggtttatgagtacatg 55521
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 45680 cttttggtttatgagtacatg 45660
>emb|CR955004.2| Medicago truncatula chromosome 5 clone mte1-9e19, WORKING DRAFT
SEQUENCE
Length = 116493
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 56870 cttttggtttatgagtacatg 56890
>gb|AC141862.44| Medicago truncatula clone mth2-33n1, WORKING DRAFT SEQUENCE, 7 ordered
pieces
Length = 134307
Score = 42.1 bits (21), Expect = 0.10
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 495 cttttggtttatgagtacatg 515
|||||||||||||||||||||
Sbjct: 74856 cttttggtttatgagtacatg 74876
>emb|CR317899.1| mte1-42P5FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 863
Score = 40.1 bits (20), Expect = 0.40
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 494 acttttggtttatgagtacatgga 517
|||||||||||||||||| |||||
Sbjct: 254 acttttggtttatgagtatatgga 231
>gb|AW686315.2|AW686315 NF036E06NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF036E06NR 5', mRNA sequence
Length = 574
Score = 40.1 bits (20), Expect = 0.40
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 496 ttttggtttatgagtacatggaga 519
||||||||||||||||||| ||||
Sbjct: 504 ttttggtttatgagtacattgaga 527
>gb|BG645280.1|BG645280 EST506899 KV3 Medicago truncatula cDNA clone pKV3-39D4 5' end, mRNA
sequence
Length = 612
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 498 ttggtttatgagtacatgga 517
||||||||||||||||||||
Sbjct: 553 ttggtttatgagtacatgga 572
>gb|CX532361.1|CX532361 s13dNF60G12MJ088_271016 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 614
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 438 gtgcagcaccgtaatcttgt 457
||||||||||||||||||||
Sbjct: 82 gtgcagcaccgtaatcttgt 101
>gb|AC146343.18| Medicago truncatula clone mth2-11a24, WORKING DRAFT SEQUENCE, 6 ordered
pieces
Length = 93546
Score = 40.1 bits (20), Expect = 0.40
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 494 acttttggtttatgagtacatgga 517
||||||||| ||||||||||||||
Sbjct: 45598 acttttggtatatgagtacatgga 45575
>emb|CT573354.1| Medicago truncatula chromosome 3 clone MTH2-18N13, *** SEQUENCING IN
PROGRESS ***, 3 unordered pieces
Length = 136526
Score = 40.1 bits (20), Expect = 0.40
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 494 acttttggtttatgagtacatgga 517
|||||||||||||||||| |||||
Sbjct: 78701 acttttggtttatgagtatatgga 78724
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 299,653
Number of Sequences: 392609
Number of extensions: 299653
Number of successful extensions: 22366
Number of sequences better than 0.5: 44
Number of HSP's better than 0.5 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 22247
Number of HSP's gapped (non-prelim): 119
length of query: 1130
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1110
effective length of database: 433,880,813
effective search space: 481607702430
effective search space used: 481607702430
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)