BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QAF14f01.yg.2.1
         (319 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AL377155.1|AL377155  MtBB29G01R1 MtBB Medicago truncatula...    60   1e-007
gb|BI272689.1|BI272689  NF024D06FL1F1057 Developing flower M...    60   1e-007
gb|CA990579.1|CA990579  EST644087 GESD Medicago truncatula c...    60   1e-007
gb|CX538323.1|CX538323  s13dNF80A11GS081_459898 Germinating ...    60   1e-007
gb|AC174296.3|  Medicago truncatula clone mth2-72l21, WORKIN...    60   1e-007
gb|CA990438.1|CA990438  EST643946 GESD Medicago truncatula c...    52   3e-005
gb|CA990448.1|CA990448  EST643956 GESD Medicago truncatula c...    52   3e-005
gb|BG581102.1|BG581102  EST482832 GVN Medicago truncatula cD...    38   0.42 

>gb|AL377155.1|AL377155 MtBB29G01R1 MtBB Medicago truncatula cDNA clone MtBB29G01 T7, mRNA
           sequence
          Length = 527

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 48  gctgatgcttggattatagccaagacccattacatgccatgacttatcca 97
           |||||||||||||||||| ||||| ||||  ||||||||||| |||||||
Sbjct: 148 gctgatgcttggattataaccaagtcccaaaacatgccatgatttatcca 99



>gb|BI272689.1|BI272689 NF024D06FL1F1057 Developing flower Medicago truncatula cDNA clone
           NF024D06FL 5', mRNA sequence
          Length = 724

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 48  gctgatgcttggattatagccaagacccattacatgccatgacttatcca 97
           |||||||||||||||||| ||||| ||||  ||||||||||| |||||||
Sbjct: 341 gctgatgcttggattataaccaagtcccaaaacatgccatgatttatcca 292



>gb|CA990579.1|CA990579 EST644087 GESD Medicago truncatula cDNA clone GESD-29M9, mRNA
           sequence
          Length = 679

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 48  gctgatgcttggattatagccaagacccattacatgccatgacttatcca 97
           |||||||||||||||||| ||||| ||||  ||||||||||| |||||||
Sbjct: 454 gctgatgcttggattataaccaagtcccaaaacatgccatgatttatcca 405



>gb|CX538323.1|CX538323 s13dNF80A11GS081_459898 Germinating Seed Medicago truncatula cDNA,
           mRNA sequence
          Length = 661

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 48  gctgatgcttggattatagccaagacccattacatgccatgacttatcca 97
           |||||||||||||||||| ||||| ||||  ||||||||||| |||||||
Sbjct: 604 gctgatgcttggattataaccaagtcccaaaacatgccatgatttatcca 555



>gb|AC174296.3| Medicago truncatula clone mth2-72l21, WORKING DRAFT SEQUENCE, 9
             unordered pieces
          Length = 114521

 Score = 60.0 bits (30), Expect = 1e-007
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 48    gctgatgcttggattatagccaagacccattacatgccatgacttatcca 97
             |||||||||||||||||| ||||| ||||  ||||||||||| |||||||
Sbjct: 51212 gctgatgcttggattataaccaagtcccaaaacatgccatgatttatcca 51163



>gb|CA990438.1|CA990438 EST643946 GESD Medicago truncatula cDNA clone GESD-28N7, mRNA
          sequence
          Length = 182

 Score = 52.0 bits (26), Expect = 3e-005
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                            
Query: 48 gctgatgcttggattatagccaagacccattacatgccatgacttatcca 97
          |||||||||||||||||| ||||  ||||  ||||||||||| |||||||
Sbjct: 81 gctgatgcttggattataaccaaatcccaaaacatgccatgatttatcca 32



>gb|CA990448.1|CA990448 EST643956 GESD Medicago truncatula cDNA clone GESD-28P9, mRNA
           sequence
          Length = 695

 Score = 52.0 bits (26), Expect = 3e-005
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 48  gctgatgcttggattatagccaagacccattacatgccatgacttatcca 97
           |||||||||||||||||| ||||  ||||  ||||||||||| |||||||
Sbjct: 320 gctgatgcttggattataaccaaatcccaaaacatgccatgatttatcca 271



>gb|BG581102.1|BG581102 EST482832 GVN Medicago truncatula cDNA clone pGVN-63F8 5' end, mRNA
           sequence
          Length = 593

 Score = 38.2 bits (19), Expect = 0.42
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                      
Query: 64  tagccaagacccattacatgccatgac 90
           ||||||| ||||| |||||||||||||
Sbjct: 392 tagccaaaacccagtacatgccatgac 366



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 34,358
Number of Sequences: 392609
Number of extensions: 34358
Number of successful extensions: 2873
Number of sequences better than  0.5: 8
Number of HSP's better than  0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 2860
Number of HSP's gapped (non-prelim): 13
length of query: 319
length of database: 441,732,993
effective HSP length: 19
effective length of query: 300
effective length of database: 434,273,422
effective search space: 130282026600
effective search space used: 130282026600
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)