BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QAF12e06.yg.2.1
         (561 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|CR342188.1|  mte1-74H8FM1 BAC end, cultivar Jemalong A17...    40   0.19 
gb|AW256460.1|AW256460  EST304597 KV2 Medicago truncatula cD...    40   0.19 
gb|CX526202.1|CX526202  s13dNF29C12AT098_510148 Aphid-Infect...    40   0.19 
gb|AC119418.5|  Medicago truncatula clone mth1-23l16, comple...    40   0.19 
gb|AC146706.8|  Medicago truncatula clone mth2-108g5, comple...    40   0.19 
gb|AC135317.10|  Medicago truncatula clone mth2-10p4, WORKIN...    40   0.19 
gb|AC148918.3|  Medicago truncatula chromosome 2 BAC clone m...    40   0.19 
emb|CR931731.1|  Medicago truncatula chromosome 5 clone mth2...    40   0.19 
gb|AC158376.1|  Medicago truncatula chromosome 2 clone mth2-...    40   0.19 
gb|AC126019.16|  Medicago truncatula clone mth2-22p22, compl...    40   0.19 
gb|AC150889.3|  Medicago truncatula chromosome 7 BAC clone m...    40   0.19 
gb|AC158498.3|  Medicago truncatula chromosome 2 BAC clone m...    40   0.19 
gb|AC151674.9|  Medicago truncatula clone mth2-28i16, WORKIN...    40   0.19 
emb|CT009568.8|  M.truncatula DNA sequence from clone MTH2-9...    40   0.19 
gb|AC145027.17|  Medicago truncatula clone mth2-15e6, comple...    40   0.19 
gb|AC122725.28|  Medicago truncatula clone mth2-4c11, WORKIN...    40   0.19 
gb|AC147537.31|  Medicago truncatula clone mth2-133k2, WORKI...    40   0.19 
gb|AC166237.5|  Medicago truncatula clone mth2-6a22, WORKING...    40   0.19 
>emb|CR342188.1| mte1-74H8FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
           genomic survey sequence
          Length = 743

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 241 tgaatgtcattgaattggat 260
           ||||||||||||||||||||
Sbjct: 587 tgaatgtcattgaattggat 568
>gb|AW256460.1|AW256460 EST304597 KV2 Medicago truncatula cDNA clone KV2-4B4, mRNA sequence
          Length = 479

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 64  tagttgttctggatgatgat 83
           ||||||||||||||||||||
Sbjct: 349 tagttgttctggatgatgat 368
>gb|CX526202.1|CX526202 s13dNF29C12AT098_510148 Aphid-Infected Shoots Medicago truncatula
           cDNA, mRNA sequence
          Length = 635

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 64  tagttgttctggatgatgat 83
           ||||||||||||||||||||
Sbjct: 156 tagttgttctggatgatgat 175
>gb|AC119418.5| Medicago truncatula clone mth1-23l16, complete sequence
          Length = 112695

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 241    tgaatgtcattgaattggat 260
              ||||||||||||||||||||
Sbjct: 106821 tgaatgtcattgaattggat 106802
>gb|AC146706.8| Medicago truncatula clone mth2-108g5, complete sequence
          Length = 106753

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 241   tgaatgtcattgaattggat 260
             ||||||||||||||||||||
Sbjct: 22956 tgaatgtcattgaattggat 22975
>gb|AC135317.10| Medicago truncatula clone mth2-10p4, WORKING DRAFT SEQUENCE, 5 ordered
             pieces
          Length = 164376

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 241   tgaatgtcattgaattggat 260
             ||||||||||||||||||||
Sbjct: 61637 tgaatgtcattgaattggat 61618
>gb|AC148918.3| Medicago truncatula chromosome 2 BAC clone mth2-44o11, complete
             sequence
          Length = 126437

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 241   tgaatgtcattgaattggat 260
             ||||||||||||||||||||
Sbjct: 91676 tgaatgtcattgaattggat 91695
>emb|CR931731.1| Medicago truncatula chromosome 5 clone mth2-83l19, COMPLETE SEQUENCE
          Length = 120299

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 241   tgaatgtcattgaattggat 260
             ||||||||||||||||||||
Sbjct: 34454 tgaatgtcattgaattggat 34435
>gb|AC158376.1| Medicago truncatula chromosome 2 clone mth2-64d17, *** SEQUENCING IN
             PROGRESS ***, 8 unordered pieces
          Length = 126018

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 241   tgaatgtcattgaattggat 260
             ||||||||||||||||||||
Sbjct: 89927 tgaatgtcattgaattggat 89946
>gb|AC126019.16| Medicago truncatula clone mth2-22p22, complete sequence
          Length = 130044

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 241   tgaatgtcattgaattggat 260
             ||||||||||||||||||||
Sbjct: 51526 tgaatgtcattgaattggat 51507
>gb|AC150889.3| Medicago truncatula chromosome 7 BAC clone mte1-61j12, complete
             sequence
          Length = 116517

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 241   tgaatgtcattgaattggat 260
             ||||||||||||||||||||
Sbjct: 82793 tgaatgtcattgaattggat 82812
>gb|AC158498.3| Medicago truncatula chromosome 2 BAC clone mth2-65n13, complete
             sequence
          Length = 124573

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 241   tgaatgtcattgaattggat 260
             ||||||||||||||||||||
Sbjct: 66913 tgaatgtcattgaattggat 66894
>gb|AC151674.9| Medicago truncatula clone mth2-28i16, WORKING DRAFT SEQUENCE
          Length = 128180

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 241   tgaatgtcattgaattggat 260
             ||||||||||||||||||||
Sbjct: 53085 tgaatgtcattgaattggat 53066
>emb|CT009568.8| M.truncatula DNA sequence from clone MTH2-95K22 on chromosome 3,
             complete sequence
          Length = 121926

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 241   tgaatgtcattgaattggat 260
             ||||||||||||||||||||
Sbjct: 40487 tgaatgtcattgaattggat 40506
>gb|AC145027.17| Medicago truncatula clone mth2-15e6, complete sequence
          Length = 122014

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 241   tgaatgtcattgaattggat 260
             ||||||||||||||||||||
Sbjct: 57842 tgaatgtcattgaattggat 57823
>gb|AC122725.28| Medicago truncatula clone mth2-4c11, WORKING DRAFT SEQUENCE, 2 ordered
             pieces
          Length = 136107

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 241   tgaatgtcattgaattggat 260
             ||||||||||||||||||||
Sbjct: 92092 tgaatgtcattgaattggat 92111
>gb|AC147537.31| Medicago truncatula clone mth2-133k2, WORKING DRAFT SEQUENCE, 2 ordered
             pieces
          Length = 162090

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 241   tgaatgtcattgaattggat 260
             ||||||||||||||||||||
Sbjct: 36674 tgaatgtcattgaattggat 36693
>gb|AC166237.5| Medicago truncatula clone mth2-6a22, WORKING DRAFT SEQUENCE, 13 ordered
             pieces
          Length = 127651

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 241   tgaatgtcattgaattggat 260
             ||||||||||||||||||||
Sbjct: 21487 tgaatgtcattgaattggat 21506
  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 128,983
Number of Sequences: 392609
Number of extensions: 128983
Number of successful extensions: 9906
Number of sequences better than  0.5: 18
Number of HSP's better than  0.5 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 9865
Number of HSP's gapped (non-prelim): 41
length of query: 561
length of database: 441,732,993
effective HSP length: 19
effective length of query: 542
effective length of database: 434,273,422
effective search space: 235376194724
effective search space used: 235376194724
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)