BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 8636641.2.1
         (1326 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC157472.3|  Medicago truncatula chromosome 7 BAC clone m...    46   0.008
gb|AL378589.1|AL378589  MtBB39C02F1 MtBB Medicago truncatula...    42   0.12 
gb|AL378591.1|AL378591  MtBB39C03F1 MtBB Medicago truncatula...    42   0.12 
gb|AC136504.23|  Medicago truncatula clone mth2-13m6, comple...    42   0.12 
gb|AW687742.2|AW687742  NF012H11RT1F1095 Developing root Med...    40   0.47 
gb|AW687321.2|AW687321  NF008D03RT1F1028 Developing root Med...    40   0.47 
gb|AW686882.2|AW686882  NF003E08RT1F1000 Developing root Med...    40   0.47 
gb|AC139852.10|  Medicago truncatula clone mth2-8n13, WORKIN...    40   0.47 

>gb|AC157472.3| Medicago truncatula chromosome 7 BAC clone mth2-41h16, complete
             sequence
          Length = 114287

 Score = 46.1 bits (23), Expect = 0.008
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 177   tccgcatgcacttccatgactgctttgtcag 207
             |||| |||||||||||||| |||||||||||
Sbjct: 48144 tccgtatgcacttccatgattgctttgtcag 48174



>gb|AL378589.1|AL378589 MtBB39C02F1 MtBB Medicago truncatula cDNA clone MtBB39C02 T3, mRNA
           sequence
          Length = 252

 Score = 42.1 bits (21), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 177 tccgcatgcacttccatgactgctt 201
           |||| ||||||||||||||||||||
Sbjct: 181 tccgaatgcacttccatgactgctt 205



>gb|AL378591.1|AL378591 MtBB39C03F1 MtBB Medicago truncatula cDNA clone MtBB39C03 T3, mRNA
           sequence
          Length = 425

 Score = 42.1 bits (21), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 177 tccgcatgcacttccatgactgctt 201
           |||| ||||||||||||||||||||
Sbjct: 163 tccgaatgcacttccatgactgctt 187



>gb|AC136504.23| Medicago truncatula clone mth2-13m6, complete sequence
          Length = 107180

 Score = 42.1 bits (21), Expect = 0.12
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 177   tccgcatgcacttccatgactgctt 201
             |||| ||||||||||||||||||||
Sbjct: 49955 tccgaatgcacttccatgactgctt 49979



>gb|AW687742.2|AW687742 NF012H11RT1F1095 Developing root Medicago truncatula cDNA clone
           NF012H11RT 5', mRNA sequence
          Length = 434

 Score = 40.1 bits (20), Expect = 0.47
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 182 atgcacttccatgactgctt 201
           ||||||||||||||||||||
Sbjct: 241 atgcacttccatgactgctt 260



>gb|AW687321.2|AW687321 NF008D03RT1F1028 Developing root Medicago truncatula cDNA clone
           NF008D03RT 5', mRNA sequence
          Length = 415

 Score = 40.1 bits (20), Expect = 0.47
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 182 atgcacttccatgactgctt 201
           ||||||||||||||||||||
Sbjct: 247 atgcacttccatgactgctt 266



>gb|AW686882.2|AW686882 NF003E08RT1F1000 Developing root Medicago truncatula cDNA clone
           NF003E08RT 5', mRNA sequence
          Length = 761

 Score = 40.1 bits (20), Expect = 0.47
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 182 atgcacttccatgactgctt 201
           ||||||||||||||||||||
Sbjct: 373 atgcacttccatgactgctt 392



>gb|AC139852.10| Medicago truncatula clone mth2-8n13, WORKING DRAFT SEQUENCE, 10 ordered
              pieces
          Length = 154519

 Score = 40.1 bits (20), Expect = 0.47
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 182    atgcacttccatgactgctt 201
              ||||||||||||||||||||
Sbjct: 134422 atgcacttccatgactgctt 134403



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 210,950
Number of Sequences: 392609
Number of extensions: 210950
Number of successful extensions: 14921
Number of sequences better than  0.5: 8
Number of HSP's better than  0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14901
Number of HSP's gapped (non-prelim): 20
length of query: 1326
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1306
effective length of database: 433,880,813
effective search space: 566648341778
effective search space used: 566648341778
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)