BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 8616263.2.1
(509 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BI309197.1|BI309197 EST530607 GPOD Medicago truncatula c... 72 5e-011
emb|CT485798.1| Medicago truncatula chromosome 5 clone mth2... 46 0.003
emb|CR340145.1| mte1-71N6RM1 BAC end, cultivar Jemalong A17... 42 0.044
emb|CR299496.1| mte1-17M20RM1 BAC end, cultivar Jemalong A1... 42 0.044
gb|CB891121.1|CB891121 EST648090 KV3 Medicago truncatula cD... 42 0.044
gb|AC125479.16| Medicago truncatula clone mth2-7f11, comple... 40 0.18
>gb|BI309197.1|BI309197 EST530607 GPOD Medicago truncatula cDNA clone pGPOD-11A15 5' end,
mRNA sequence
Length = 705
Score = 71.9 bits (36), Expect = 5e-011
Identities = 42/44 (95%)
Strand = Plus / Plus
Query: 352 ccccatgttgtgtgcgcctccaaatggcaatgcatgaaccaaac 395
||||||||||| ||| ||||||||||||||||||||||||||||
Sbjct: 420 ccccatgttgtatgcacctccaaatggcaatgcatgaaccaaac 463
>emb|CT485798.1| Medicago truncatula chromosome 5 clone mth2-24d7, WORKING DRAFT
SEQUENCE
Length = 116322
Score = 46.1 bits (23), Expect = 0.003
Identities = 26/27 (96%)
Strand = Plus / Plus
Query: 369 ctccaaatggcaatgcatgaaccaaac 395
||||||||| |||||||||||||||||
Sbjct: 51248 ctccaaatgacaatgcatgaaccaaac 51274
>emb|CR340145.1| mte1-71N6RM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 625
Score = 42.1 bits (21), Expect = 0.044
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 375 atggcaatgcatgaaccaaac 395
|||||||||||||||||||||
Sbjct: 455 atggcaatgcatgaaccaaac 475
>emb|CR299496.1| mte1-17M20RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 544
Score = 42.1 bits (21), Expect = 0.044
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 375 atggcaatgcatgaaccaaac 395
|||||||||||||||||||||
Sbjct: 455 atggcaatgcatgaaccaaac 475
>gb|CB891121.1|CB891121 EST648090 KV3 Medicago truncatula cDNA clone KV3-49A12, mRNA
sequence
Length = 706
Score = 42.1 bits (21), Expect = 0.044
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 375 atggcaatgcatgaaccaaac 395
|||||||||||||||||||||
Sbjct: 363 atggcaatgcatgaaccaaac 383
>gb|AC125479.16| Medicago truncatula clone mth2-7f11, complete sequence
Length = 114214
Score = 40.1 bits (20), Expect = 0.18
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 191 aaactttcatttgtctaattcaca 214
|||||||||||||| |||||||||
Sbjct: 29666 aaactttcatttgtttaattcaca 29689
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 130,815
Number of Sequences: 392609
Number of extensions: 130815
Number of successful extensions: 8549
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8535
Number of HSP's gapped (non-prelim): 14
length of query: 509
length of database: 441,732,993
effective HSP length: 19
effective length of query: 490
effective length of database: 434,273,422
effective search space: 212793976780
effective search space used: 212793976780
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)