BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 8010573.2.1
         (1223 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|CR343323.1|  mte1-76O8RM1 BAC end, cultivar Jemalong A17...    42   0.11 
gb|AW574197.1|AW574197  EST316788 GVN Medicago truncatula cD...    42   0.11 
gb|BF640981.1|BF640981  NF059H12IN1F1103 Insect herbivory Me...    42   0.11 
gb|BG647282.1|BG647282  EST508901 HOGA Medicago truncatula c...    42   0.11 
gb|CB894697.1|CB894697  EST647489 HOGA Medicago truncatula c...    42   0.11 

>emb|CR343323.1| mte1-76O8RM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
           genomic survey sequence
          Length = 586

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 86  accgatcgatcgatcgatcga 106
           |||||||||||||||||||||
Sbjct: 229 accgatcgatcgatcgatcga 209



>gb|AW574197.1|AW574197 EST316788 GVN Medicago truncatula cDNA clone pGVN-51L17, mRNA
           sequence
          Length = 496

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 886 atgatctacaactactgcaccgata 910
           |||||||||||||||||||| ||||
Sbjct: 252 atgatctacaactactgcactgata 276



>gb|BF640981.1|BF640981 NF059H12IN1F1103 Insect herbivory Medicago truncatula cDNA clone
           NF059H12IN 5', mRNA sequence
          Length = 663

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 86  accgatcgatcgatcgatcga 106
           |||||||||||||||||||||
Sbjct: 14  accgatcgatcgatcgatcga 34



>gb|BG647282.1|BG647282 EST508901 HOGA Medicago truncatula cDNA clone pHOGA-16O5 5' end,
           mRNA sequence
          Length = 759

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 886 atgatctacaactactgcaccgata 910
           |||||||||||||||||||| ||||
Sbjct: 688 atgatctacaactactgcactgata 712



>gb|CB894697.1|CB894697 EST647489 HOGA Medicago truncatula cDNA clone HOGA-32G9, mRNA
           sequence
          Length = 350

 Score = 42.1 bits (21), Expect = 0.11
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 886 atgatctacaactactgcaccgata 910
           |||||||||||||||||||| ||||
Sbjct: 181 atgatctacaactactgcactgata 205



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 113,671
Number of Sequences: 392609
Number of extensions: 113671
Number of successful extensions: 8550
Number of sequences better than  0.5: 5
Number of HSP's better than  0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8533
Number of HSP's gapped (non-prelim): 11
length of query: 1223
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1203
effective length of database: 433,880,813
effective search space: 521958618039
effective search space used: 521958618039
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)