BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 5351892.2.1
         (466 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BE942558.1|BE942558  EST422137 MGHG Medicago truncatula c...    42   0.041
gb|AL368055.1|AL368055  MtBA21H09F1 MtBA Medicago truncatula...    40   0.16 
gb|BE942553.1|BE942553  EST422132 MGHG Medicago truncatula c...    40   0.16 
gb|BE942557.1|BE942557  EST422136 MGHG Medicago truncatula c...    40   0.16 
gb|BF642553.1|BF642553  NF069H08IN1F1075 Insect herbivory Me...    40   0.16 
gb|BF650883.1|BF650883  NF097E12EC1F1097 Elicited cell cultu...    40   0.16 
gb|CB891185.1|CB891185  EST648154 KV3 Medicago truncatula cD...    40   0.16 
gb|AC146587.20|  Medicago truncatula clone mth2-144j8, compl...    40   0.16 
gb|AC126007.16|  Medicago truncatula clone mth2-11o4, comple...    40   0.16 
gb|AC146972.29|  Medicago truncatula clone mth2-128d9, WORKI...    40   0.16 

>gb|BE942558.1|BE942558 EST422137 MGHG Medicago truncatula cDNA clone pMGHG-8J6, mRNA
           sequence
          Length = 585

 Score = 42.1 bits (21), Expect = 0.041
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 gcttattcttattcttcttct 314
           |||||||||||||||||||||
Sbjct: 90  gcttattcttattcttcttct 110



>gb|AL368055.1|AL368055 MtBA21H09F1 MtBA Medicago truncatula cDNA clone MtBA21H09 T3, mRNA
           sequence
          Length = 513

 Score = 40.1 bits (20), Expect = 0.16
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 295 cttattcttattcttcttct 314
           ||||||||||||||||||||
Sbjct: 51  cttattcttattcttcttct 70



>gb|BE942553.1|BE942553 EST422132 MGHG Medicago truncatula cDNA clone pMGHG-8H24, mRNA
           sequence
          Length = 556

 Score = 40.1 bits (20), Expect = 0.16
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 295 cttattcttattcttcttct 314
           ||||||||||||||||||||
Sbjct: 86  cttattcttattcttcttct 105



>gb|BE942557.1|BE942557 EST422136 MGHG Medicago truncatula cDNA clone pMGHG-8J6, mRNA
           sequence
          Length = 548

 Score = 40.1 bits (20), Expect = 0.16
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 295 cttattcttattcttcttct 314
           ||||||||||||||||||||
Sbjct: 79  cttattcttattcttcttct 98



>gb|BF642553.1|BF642553 NF069H08IN1F1075 Insect herbivory Medicago truncatula cDNA clone
           NF069H08IN 5', mRNA sequence
          Length = 666

 Score = 40.1 bits (20), Expect = 0.16
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 295 cttattcttattcttcttct 314
           ||||||||||||||||||||
Sbjct: 106 cttattcttattcttcttct 125



>gb|BF650883.1|BF650883 NF097E12EC1F1097 Elicited cell culture Medicago truncatula cDNA
           clone NF097E12EC 5', mRNA sequence
          Length = 653

 Score = 40.1 bits (20), Expect = 0.16
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 295 cttattcttattcttcttct 314
           ||||||||||||||||||||
Sbjct: 102 cttattcttattcttcttct 121



>gb|CB891185.1|CB891185 EST648154 KV3 Medicago truncatula cDNA clone KV3-49M18, mRNA
           sequence
          Length = 781

 Score = 40.1 bits (20), Expect = 0.16
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 295 cttattcttattcttcttct 314
           ||||||||||||||||||||
Sbjct: 37  cttattcttattcttcttct 56



>gb|AC146587.20| Medicago truncatula clone mth2-144j8, complete sequence
          Length = 113373

 Score = 40.1 bits (20), Expect = 0.16
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 295   cttattcttattcttcttct 314
             ||||||||||||||||||||
Sbjct: 20061 cttattcttattcttcttct 20080



>gb|AC126007.16| Medicago truncatula clone mth2-11o4, complete sequence
          Length = 106747

 Score = 40.1 bits (20), Expect = 0.16
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 295   cttattcttattcttcttct 314
             ||||||||||||||||||||
Sbjct: 81105 cttattcttattcttcttct 81086



>gb|AC146972.29| Medicago truncatula clone mth2-128d9, WORKING DRAFT SEQUENCE, 2 ordered
             pieces
          Length = 147260

 Score = 40.1 bits (20), Expect = 0.16
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 295   cttattcttattcttcttct 314
             ||||||||||||||||||||
Sbjct: 25116 cttattcttattcttcttct 25135



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 120,927
Number of Sequences: 392609
Number of extensions: 120927
Number of successful extensions: 9991
Number of sequences better than  0.5: 10
Number of HSP's better than  0.5 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 9972
Number of HSP's gapped (non-prelim): 19
length of query: 466
length of database: 441,732,993
effective HSP length: 19
effective length of query: 447
effective length of database: 434,273,422
effective search space: 194120219634
effective search space used: 194120219634
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)