BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 5110719.2.1
(581 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW684291.1|AW684291 NF015B02NR1F1000 Nodulated root Medi... 46 0.003
gb|CX532547.1|CX532547 s13dNF73D09MJ074_271381 Methyl Jasmo... 46 0.003
gb|AW776924.1|AW776924 EST335989 DSIL Medicago truncatula c... 44 0.013
gb|BE202685.1|BE202685 EST402707 KV1 Medicago truncatula cD... 44 0.013
gb|AL380060.1|AL380060 MtBB50B07F1 MtBB Medicago truncatula... 44 0.013
gb|BF003952.1|BF003952 EST432450 KV1 Medicago truncatula cD... 44 0.013
gb|BF641878.1|BF641878 NF051B03IN1F1028 Insect herbivory Me... 44 0.013
gb|BF645185.1|BF645185 NF037G12EC1F1099 Elicited cell cultu... 44 0.013
gb|BG450990.1|BG450990 NF097F03DT1F1029 Drought Medicago tr... 44 0.013
gb|BG453105.1|BG453105 NF090G12LF1F1097 Developing leaf Med... 44 0.013
gb|BG453939.1|BG453939 NF096C06LF1F1039 Developing leaf Med... 44 0.013
gb|BG647218.1|BG647218 EST508837 HOGA Medicago truncatula c... 44 0.013
gb|BI266414.1|BI266414 NF103H04IN1F1044 Insect herbivory Me... 44 0.013
gb|BI309299.1|BI309299 EST530709 GPOD Medicago truncatula c... 44 0.013
gb|CB892496.1|CB892496 EST649465 KV3 Medicago truncatula cD... 44 0.013
gb|CX529905.1|CX529905 s13dNF55E12MJ088_245850 Methyl Jasmo... 44 0.013
gb|DW016087.1|DW016087 EST1225048 MTY Medicago truncatula c... 44 0.013
gb|DW019329.1|DW019329 EST1228290 MTY Medicago truncatula c... 44 0.013
gb|BF518464.1|BF518464 EST455911 DSIL Medicago truncatula c... 42 0.051
gb|CF067988.1|CF067988 EST668709 MTUS Medicago truncatula c... 42 0.051
gb|AC147517.23| Medicago truncatula clone mth2-49o4, WORKIN... 42 0.051
>gb|AW684291.1|AW684291 NF015B02NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF015B02NR 5', mRNA sequence
Length = 546
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 1 gattaacaatataccatgtaaaaagtcacttgcagaaatacag 43
||||||| ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 247 gattaactatatatcatgttaaaagccacttacagaaatacag 289
Score = 42.1 bits (21), Expect = 0.051
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 164 actgcagatggaggtccaaaagcggctgcacgaacag 200
|||||||||||||||||| || ||| |||| ||||||
Sbjct: 407 actgcagatggaggtccagaaacggttgcatgaacag 443
>gb|CX532547.1|CX532547 s13dNF73D09MJ074_271381 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 611
Score = 46.1 bits (23), Expect = 0.003
Identities = 38/43 (88%)
Strand = Plus / Plus
Query: 1 gattaacaatataccatgtaaaaagtcacttgcagaaatacag 43
||||||| ||||| ||||| ||||| ||||| |||||||||||
Sbjct: 561 gattaactatatatcatgttaaaagccacttacagaaatacag 603
>gb|AW776924.1|AW776924 EST335989 DSIL Medicago truncatula cDNA clone pDSIL-16F10, mRNA
sequence
Length = 615
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 361 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 410
>gb|BE202685.1|BE202685 EST402707 KV1 Medicago truncatula cDNA clone pKV1-2H8, mRNA
sequence
Length = 519
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 315 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 364
>gb|AL380060.1|AL380060 MtBB50B07F1 MtBB Medicago truncatula cDNA clone MtBB50B07 T3, mRNA
sequence
Length = 478
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 358 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 407
>gb|BF003952.1|BF003952 EST432450 KV1 Medicago truncatula cDNA clone pKV1-14M1, mRNA
sequence
Length = 541
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 284 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 333
>gb|BF641878.1|BF641878 NF051B03IN1F1028 Insect herbivory Medicago truncatula cDNA clone
NF051B03IN 5', mRNA sequence
Length = 690
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 346 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 395
>gb|BF645185.1|BF645185 NF037G12EC1F1099 Elicited cell culture Medicago truncatula cDNA
clone NF037G12EC 5', mRNA sequence
Length = 651
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 396 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 445
>gb|BG450990.1|BG450990 NF097F03DT1F1029 Drought Medicago truncatula cDNA clone NF097F03DT
5', mRNA sequence
Length = 646
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 108 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 157
>gb|BG453105.1|BG453105 NF090G12LF1F1097 Developing leaf Medicago truncatula cDNA clone
NF090G12LF 5', mRNA sequence
Length = 661
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 108 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 157
>gb|BG453939.1|BG453939 NF096C06LF1F1039 Developing leaf Medicago truncatula cDNA clone
NF096C06LF 5', mRNA sequence
Length = 658
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 108 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 157
>gb|BG647218.1|BG647218 EST508837 HOGA Medicago truncatula cDNA clone pHOGA-16C19 5' end,
mRNA sequence
Length = 817
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 313 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 362
>gb|BI266414.1|BI266414 NF103H04IN1F1044 Insect herbivory Medicago truncatula cDNA clone
NF103H04IN 5', mRNA sequence
Length = 664
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 382 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 431
>gb|BI309299.1|BI309299 EST530709 GPOD Medicago truncatula cDNA clone pGPOD-11E2 5' end,
mRNA sequence
Length = 608
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 354 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 403
>gb|CB892496.1|CB892496 EST649465 KV3 Medicago truncatula cDNA clone KV3-54P17, mRNA
sequence
Length = 557
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 318 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 367
>gb|CX529905.1|CX529905 s13dNF55E12MJ088_245850 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 578
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 357 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 406
>gb|DW016087.1|DW016087 EST1225048 MTY Medicago truncatula cDNA clone MTYAD02, mRNA
sequence
Length = 563
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 295 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 344
>gb|DW019329.1|DW019329 EST1228290 MTY Medicago truncatula cDNA clone MTYBH65, mRNA
sequence
Length = 872
Score = 44.1 bits (22), Expect = 0.013
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 3 ttaacaatataccatgtaaaaagtcacttgcagaaatacagactagcaaa 52
||||| || |||||||| || || || |||||||||||| ||||||||||
Sbjct: 356 ttaaccatttaccatgtcaagagccatttgcagaaataccgactagcaaa 405
>gb|BF518464.1|BF518464 EST455911 DSIL Medicago truncatula cDNA clone pDSIL-5K15, mRNA
sequence
Length = 525
Score = 42.1 bits (21), Expect = 0.051
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 164 actgcagatggaggtccaaaagcggctgcacgaacag 200
|||||||||||||||||| || ||| |||| ||||||
Sbjct: 58 actgcagatggaggtccagaaacggttgcatgaacag 94
>gb|CF067988.1|CF067988 EST668709 MTUS Medicago truncatula cDNA clone MTUS-2C8, mRNA
sequence
Length = 768
Score = 42.1 bits (21), Expect = 0.051
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 164 actgcagatggaggtccaaaagcggctgcacgaacag 200
|||||||||||||||||| || ||| |||| ||||||
Sbjct: 43 actgcagatggaggtccagaaacggttgcatgaacag 79
>gb|AC147517.23| Medicago truncatula clone mth2-49o4, WORKING DRAFT SEQUENCE
Length = 125526
Score = 42.1 bits (21), Expect = 0.051
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 164 actgcagatggaggtccaaaagcggctgcacgaacag 200
|||||||||||||||||| || ||| |||| ||||||
Sbjct: 16966 actgcagatggaggtccagaaacggttgcatgaacag 16930
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 105,092
Number of Sequences: 392609
Number of extensions: 105092
Number of successful extensions: 6949
Number of sequences better than 0.5: 21
Number of HSP's better than 0.5 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 6918
Number of HSP's gapped (non-prelim): 31
length of query: 581
length of database: 441,732,993
effective HSP length: 19
effective length of query: 562
effective length of database: 434,273,422
effective search space: 244061663164
effective search space used: 244061663164
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)