BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 44956.2.1
(1252 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BF649017.1|BF649017 NF051F10EC1F1089 Elicited cell cultu... 96 9e-018
gb|CF068383.1|CF068383 EST669104 MTUS Medicago truncatula c... 62 1e-007
gb|CA919067.1|CA919067 EST636785 MTUS Medicago truncatula c... 60 5e-007
emb|CR343497.1| mte1-76P3FM1 BAC end, cultivar Jemalong A17... 52 1e-004
gb|AW267848.1|AW267848 EST306126 DSIR Medicago truncatula c... 52 1e-004
gb|BE124682.1|BE124682 EST393717 GVN Medicago truncatula cD... 52 1e-004
gb|BF637006.1|BF637006 NF074C05LF1F1035 Developing leaf Med... 52 1e-004
gb|BF636155.1|BF636155 NF077G06DT1F1051 Drought Medicago tr... 44 0.028
gb|AC173337.3| Medicago truncatula clone mth2-130f5, WORKIN... 42 0.11
emb|CR491380.1| mth2-164B16FM1 BAC end, cultivar Jemalong A... 40 0.44
gb|BE240001.1|BE240001 EST404050 MHRP- Medicago truncatula ... 40 0.44
gb|AL387447.1|AL387447 MtBC42F07F1 MtBC Medicago truncatula... 40 0.44
gb|BG588350.1|BG588350 EST490159 MHRP- Medicago truncatula ... 40 0.44
gb|CX532602.1|CX532602 s13dNF88B11MJ089_271489 Methyl Jasmo... 40 0.44
>gb|BF649017.1|BF649017 NF051F10EC1F1089 Elicited cell culture Medicago truncatula cDNA
clone NF051F10EC 5', mRNA sequence
Length = 662
Score = 95.6 bits (48), Expect = 9e-018
Identities = 228/288 (79%)
Strand = Plus / Minus
Query: 366 ggcagtcatatcagatgcaatgaaccctggtgcaatagcattcacattgatatttctgct 425
||||||||| |||||||||||||| ||||| |||| |||||| ||| |||| ||||||
Sbjct: 429 ggcagtcatgtcagatgcaatgaatcctggagcaacagcattaacagtgatgcctctgct 370
Query: 426 tgcatactccctggcaactgtttttgtgaaaccaatcactccagccttggctgcgctata 485
| ||| ||| | ||||| | |||||| | ||||| ||||| || || || || |||
Sbjct: 369 agaatattcctttgcaacagattttgtcaggccaattactcctgcttttgcagcagcata 310
Query: 486 attagcttggccaacattgccagtaagaccaactacagatgcaatgttgataatttttcc 545
||| ||||| ||| |||||||| | | |||||| || |||| ||||||||| || ||||
Sbjct: 309 attggcttgtccagcattgccaatcaaaccaacaactgatgaaatgttgattatccttcc 250
Query: 546 ctttctctttttcatcattacttttgttgcagcctgtgtacaaaggaagacaccagtaag 605
|||| | || |||||||| | || | || |||||||| |||| || |||||||| ||
Sbjct: 249 ctttttattcttcatcataatcttagcagctgcctgtgtggaaagaaaaacaccagtgag 190
Query: 606 attcagatcaattacgtcttgccactgagatttcttcatcctcatcaa 653
||| |||||||| || || ||||||||||| |||||||| ||||||||
Sbjct: 189 atttagatcaataacctcctgccactgagacttcttcattctcatcaa 142
>gb|CF068383.1|CF068383 EST669104 MTUS Medicago truncatula cDNA clone MTUS-7C10, mRNA
sequence
Length = 813
Score = 61.9 bits (31), Expect = 1e-007
Identities = 52/59 (88%)
Strand = Plus / Minus
Query: 595 acaccagtaagattcagatcaattacgtcttgccactgagatttcttcatcctcatcaa 653
|||||||| ||||| |||||||| || || ||||||||||| |||||||| ||||||||
Sbjct: 681 acaccagtgagatttagatcaataacctcctgccactgagacttcttcattctcatcaa 623
Score = 52.0 bits (26), Expect = 1e-004
Identities = 62/74 (83%)
Strand = Plus / Minus
Query: 796 tcaatctctttggagacctcttcagcctctttcgaggaccgggcatagtttaccagaacc 855
|||||||| ||||| ||||||||||| || || || || | |||||||| |||| ||||
Sbjct: 480 tcaatctccttggaaacctcttcagcttccttggatgatcttgcatagttgaccaaaacc 421
Query: 856 ttgcatcctgcttt 869
||||| ||||||||
Sbjct: 420 ttgcaacctgcttt 407
>gb|CA919067.1|CA919067 EST636785 MTUS Medicago truncatula cDNA clone MTUS-7C10, mRNA
sequence
Length = 795
Score = 60.0 bits (30), Expect = 5e-007
Identities = 156/198 (78%)
Strand = Plus / Plus
Query: 366 ggcagtcatatcagatgcaatgaaccctggtgcaatagcattcacattgatatttctgct 425
||||||||| |||||||||||||| ||||| |||| |||||| ||| |||| ||||||
Sbjct: 500 ggcagtcatgtcagatgcaatgaatcctggagcaacagcattaacagtgatgcctctgct 559
Query: 426 tgcatactccctggcaactgtttttgtgaaaccaatcactccagccttggctgcgctata 485
| ||| ||| | ||||| | |||||| | ||||| ||||| || || || || |||
Sbjct: 560 agaatattcctttgcaacagattttgtcaggccaattactcctgcttttgcagcagcata 619
Query: 486 attagcttggccaacattgccagtaagaccaactacagatgcaatgttgataatttttcc 545
||| ||||| ||| |||||||| | | |||||| || |||| ||||||||| || ||||
Sbjct: 620 attggcttgtccagcattgccaatcaaaccaacaactgatgaaatgttgattatccttcc 679
Query: 546 ctttctctttttcatcat 563
|||| | || ||||||||
Sbjct: 680 ctttttattcttcatcat 697
>emb|CR343497.1| mte1-76P3FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 750
Score = 52.0 bits (26), Expect = 1e-004
Identities = 38/42 (90%)
Strand = Plus / Plus
Query: 366 ggcagtcatatcagatgcaatgaaccctggtgcaatagcatt 407
||||||||| |||||||||||||| ||||| |||| ||||||
Sbjct: 195 ggcagtcatgtcagatgcaatgaatcctggagcaacagcatt 236
>gb|AW267848.1|AW267848 EST306126 DSIR Medicago truncatula cDNA clone pDSIR-8C16, mRNA
sequence
Length = 607
Score = 52.0 bits (26), Expect = 1e-004
Identities = 62/74 (83%)
Strand = Plus / Minus
Query: 796 tcaatctctttggagacctcttcagcctctttcgaggaccgggcatagtttaccagaacc 855
|||||||| ||||| ||||||||||| || || || || | |||||||| |||| ||||
Sbjct: 486 tcaatctccttggaaacctcttcagcttccttggatgatcttgcatagttgaccaaaacc 427
Query: 856 ttgcatcctgcttt 869
||||| ||||||||
Sbjct: 426 ttgcaacctgcttt 413
>gb|BE124682.1|BE124682 EST393717 GVN Medicago truncatula cDNA clone pGVN-67E16, mRNA
sequence
Length = 552
Score = 52.0 bits (26), Expect = 1e-004
Identities = 62/74 (83%)
Strand = Plus / Minus
Query: 796 tcaatctctttggagacctcttcagcctctttcgaggaccgggcatagtttaccagaacc 855
|||||||| ||||| ||||||||||| || || || || | |||||||| |||| ||||
Sbjct: 519 tcaatctccttggaaacctcttcagcttccttggatgatcttgcatagttgaccaaaacc 460
Query: 856 ttgcatcctgcttt 869
||||| ||||||||
Sbjct: 459 ttgcaacctgcttt 446
>gb|BF637006.1|BF637006 NF074C05LF1F1035 Developing leaf Medicago truncatula cDNA clone
NF074C05LF 5', mRNA sequence
Length = 549
Score = 52.0 bits (26), Expect = 1e-004
Identities = 62/74 (83%)
Strand = Plus / Minus
Query: 796 tcaatctctttggagacctcttcagcctctttcgaggaccgggcatagtttaccagaacc 855
|||||||| ||||| ||||||||||| || || || || | |||||||| |||| ||||
Sbjct: 427 tcaatctccttggaaacctcttcagcttccttggatgatcttgcatagttgaccaaaacc 368
Query: 856 ttgcatcctgcttt 869
||||| ||||||||
Sbjct: 367 ttgcaacctgcttt 354
>gb|BF636155.1|BF636155 NF077G06DT1F1051 Drought Medicago truncatula cDNA clone NF077G06DT
5', mRNA sequence
Length = 647
Score = 44.1 bits (22), Expect = 0.028
Identities = 61/74 (82%)
Strand = Plus / Minus
Query: 796 tcaatctctttggagacctcttcagcctctttcgaggaccgggcatagtttaccagaacc 855
|||||||| ||||| ||||||||||| || || || || | |||||||| |||| | ||
Sbjct: 533 tcaatctccttggaaacctcttcagcttccttggatgatcttgcatagttgaccaaaccc 474
Query: 856 ttgcatcctgcttt 869
||||| ||||||||
Sbjct: 473 ttgcaacctgcttt 460
>gb|AC173337.3| Medicago truncatula clone mth2-130f5, WORKING DRAFT SEQUENCE, 22
unordered pieces
Length = 101213
Score = 42.1 bits (21), Expect = 0.11
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 794 cttcaatctctttggagacct 814
|||||||||||||||||||||
Sbjct: 7533 cttcaatctctttggagacct 7513
>emb|CR491380.1| mth2-164B16FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 608
Score = 40.1 bits (20), Expect = 0.44
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 540 ttttccctttctctttttcatcat 563
||||||||||||| ||||||||||
Sbjct: 516 ttttccctttctccttttcatcat 493
>gb|BE240001.1|BE240001 EST404050 MHRP- Medicago truncatula cDNA clone pMHRP-41O14, mRNA
sequence
Length = 419
Score = 40.1 bits (20), Expect = 0.44
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 338 ttttcttctcaagctcttct 357
||||||||||||||||||||
Sbjct: 285 ttttcttctcaagctcttct 266
>gb|AL387447.1|AL387447 MtBC42F07F1 MtBC Medicago truncatula cDNA clone MtBC42F07 T3, mRNA
sequence
Length = 294
Score = 40.1 bits (20), Expect = 0.44
Identities = 53/64 (82%)
Strand = Plus / Minus
Query: 805 ttggagacctcttcagcctctttcgaggaccgggcatagtttaccagaaccttgcatcct 864
||||| ||||||||||| || || || || | |||||||| |||| ||||||||| |||
Sbjct: 64 ttggaaacctcttcagcttccttggatgatcttgcatagttgaccaaaaccttgcaacct 5
Query: 865 gctt 868
||||
Sbjct: 4 gctt 1
>gb|BG588350.1|BG588350 EST490159 MHRP- Medicago truncatula cDNA clone pMHRP-47N11, mRNA
sequence
Length = 320
Score = 40.1 bits (20), Expect = 0.44
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 338 ttttcttctcaagctcttct 357
||||||||||||||||||||
Sbjct: 173 ttttcttctcaagctcttct 154
>gb|CX532602.1|CX532602 s13dNF88B11MJ089_271489 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 600
Score = 40.1 bits (20), Expect = 0.44
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 338 ttttcttctcaagctcttct 357
||||||||||||||||||||
Sbjct: 527 ttttcttctcaagctcttct 508
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 361,925
Number of Sequences: 392609
Number of extensions: 361925
Number of successful extensions: 28597
Number of sequences better than 0.5: 14
Number of HSP's better than 0.5 without gapping: 9
Number of HSP's successfully gapped in prelim test: 5
Number of HSP's that attempted gapping in prelim test: 28570
Number of HSP's gapped (non-prelim): 35
length of query: 1252
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1232
effective length of database: 433,880,813
effective search space: 534541161616
effective search space used: 534541161616
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)