BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3829501.2.1
(1141 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BG449009.1|BG449009 NF003G12IN1F1100 Insect herbivory Me... 48 0.002
gb|BI269537.1|BI269537 NF004F09IR1F1078 Irradiated Medicago... 48 0.002
gb|BQ124909.1|BQ124909 EST610485 GLSD Medicago truncatula c... 48 0.002
gb|BQ143906.1|BQ143906 NF037F02DT1F1016 Drought Medicago tr... 48 0.002
gb|BQ153299.1|BQ153299 NF033G05IR1F1038 Irradiated Medicago... 48 0.002
gb|BQ155428.1|BQ155428 NF080D07IR1F1062 Irradiated Medicago... 48 0.002
gb|BQ155812.1|BQ155812 NF084E11IR1F1087 Irradiated Medicago... 48 0.002
gb|BQ155892.1|BQ155892 NF085D01IR1F1014 Irradiated Medicago... 48 0.002
gb|BQ155911.1|BQ155911 NF085F02IR1F1027 Irradiated Medicago... 48 0.002
gb|BQ156286.1|BQ156286 NF091C01IR1F1006 Irradiated Medicago... 48 0.002
gb|BQ165638.1|BQ165638 EST611507 KVKC Medicago truncatula c... 48 0.002
gb|CX517163.1|CX517163 s13dNF14D07VI062_398797 Virus-Infect... 48 0.002
gb|CX517299.1|CX517299 s13dNF07C08VI066_399617 Virus-Infect... 48 0.002
gb|CX520567.1|CX520567 s13dNF57C09VI068_448920 Virus-Infect... 48 0.002
gb|CX523055.1|CX523055 s13dNF88B10VI089_471914 Virus-Infect... 48 0.002
gb|AC148763.14| Medicago truncatula clone mth2-29o24, compl... 48 0.002
gb|AW560048.1|AW560048 EST315096 DSIR Medicago truncatula c... 46 0.007
gb|AL382691.1|AL382691 MtBC09D09F1 MtBC Medicago truncatula... 46 0.007
gb|BE942180.1|BE942180 EST421759 MGHG Medicago truncatula c... 46 0.007
gb|BE943303.1|BE943303 EST422882 MGHG Medicago truncatula c... 46 0.007
gb|BE997567.1|BE997567 EST429290 GVSN Medicago truncatula c... 46 0.007
gb|BE997667.1|BE997667 EST429390 GVSN Medicago truncatula c... 46 0.007
gb|BF637904.1|BF637904 NF029F08PL1F1073 Phosphate starved l... 46 0.007
gb|BF638282.1|BF638282 NF053C09PL1F1068 Phosphate starved l... 46 0.007
gb|BF650277.1|BF650277 NF087B10EC1F1079 Elicited cell cultu... 46 0.007
gb|AW687771.2|AW687771 NF013C08RT1F1065 Developing root Med... 46 0.007
gb|BQ152522.1|BQ152522 NF019F07IR1F1061 Irradiated Medicago... 46 0.007
gb|BQ155216.1|BQ155216 NF077E04IR1F1035 Irradiated Medicago... 46 0.007
gb|BQ157165.1|BQ157165 NF101F12IR1F1103 Irradiated Medicago... 46 0.007
gb|BQ165427.1|BQ165427 EST611296 KVKC Medicago truncatula c... 46 0.007
gb|BQ165428.1|BQ165428 EST611297 KVKC Medicago truncatula c... 46 0.007
gb|CB892183.1|CB892183 EST649152 KV3 Medicago truncatula cD... 46 0.007
gb|CB893707.1|CB893707 EST646499 HOGA Medicago truncatula c... 46 0.007
gb|CB893753.1|CB893753 EST646545 HOGA Medicago truncatula c... 46 0.007
gb|CB895070.1|CB895070 EST647862 HOGA Medicago truncatula c... 46 0.007
gb|AJ500330.1|AJ500330 AJ500330 MTGIM Medicago truncatula c... 46 0.007
gb|CX531641.1|CX531641 s13dNF80C04MJ022_257227 Methyl Jasmo... 46 0.007
gb|AC121239.34| Medicago truncatula clone mth1-8p19, comple... 46 0.007
emb|Y10373.1|MTCHITIN1 M.truncatula mRNA for chitinase 46 0.007
emb|CT025534.4| M.truncatula DNA sequence from clone MTH2-1... 46 0.007
gb|AW560047.1|AW560047 EST315095 DSIR Medicago truncatula c... 40 0.40
gb|CA858965.1|CA858965 EST636220 GLSD Medicago truncatula c... 40 0.40
gb|AC140032.4| Medicago truncatula clone mth2-10i23, comple... 40 0.40
gb|AC150203.13| Medicago truncatula clone mth2-65b23, compl... 40 0.40
>gb|BG449009.1|BG449009 NF003G12IN1F1100 Insect herbivory Medicago truncatula cDNA clone
NF003G12IN 5', mRNA sequence
Length = 557
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 254 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 297
>gb|BI269537.1|BI269537 NF004F09IR1F1078 Irradiated Medicago truncatula cDNA clone
NF004F09IR 5', mRNA sequence
Length = 618
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 335 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 292
>gb|BQ124909.1|BQ124909 EST610485 GLSD Medicago truncatula cDNA clone pGLSD-37H15, mRNA
sequence
Length = 783
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 763 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 720
>gb|BQ143906.1|BQ143906 NF037F02DT1F1016 Drought Medicago truncatula cDNA clone NF037F02DT
5', mRNA sequence
Length = 806
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 352 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 309
>gb|BQ153299.1|BQ153299 NF033G05IR1F1038 Irradiated Medicago truncatula cDNA clone
NF033G05IR 5', mRNA sequence
Length = 432
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 335 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 292
>gb|BQ155428.1|BQ155428 NF080D07IR1F1062 Irradiated Medicago truncatula cDNA clone
NF080D07IR 5', mRNA sequence
Length = 615
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 335 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 292
>gb|BQ155812.1|BQ155812 NF084E11IR1F1087 Irradiated Medicago truncatula cDNA clone
NF084E11IR 5', mRNA sequence
Length = 623
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 335 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 292
>gb|BQ155892.1|BQ155892 NF085D01IR1F1014 Irradiated Medicago truncatula cDNA clone
NF085D01IR 5', mRNA sequence
Length = 629
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 335 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 292
>gb|BQ155911.1|BQ155911 NF085F02IR1F1027 Irradiated Medicago truncatula cDNA clone
NF085F02IR 5', mRNA sequence
Length = 626
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 335 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 292
>gb|BQ156286.1|BQ156286 NF091C01IR1F1006 Irradiated Medicago truncatula cDNA clone
NF091C01IR 5', mRNA sequence
Length = 611
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 335 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 292
>gb|BQ165638.1|BQ165638 EST611507 KVKC Medicago truncatula cDNA clone pKVKC-10F8, mRNA
sequence
Length = 737
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 226 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 269
>gb|CX517163.1|CX517163 s13dNF14D07VI062_398797 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 314
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 80 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 37
>gb|CX517299.1|CX517299 s13dNF07C08VI066_399617 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 532
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 377 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 334
>gb|CX520567.1|CX520567 s13dNF57C09VI068_448920 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 530
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 375 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 332
>gb|CX523055.1|CX523055 s13dNF88B10VI089_471914 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 544
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 498 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 455
>gb|AC148763.14| Medicago truncatula clone mth2-29o24, complete sequence
Length = 104879
Score = 48.1 bits (24), Expect = 0.002
Identities = 39/44 (88%)
Strand = Plus / Plus
Query: 269 ccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 312
||||| ||||| ||||||||||| |||||||||| ||||||||
Sbjct: 29219 ccgcattcgagcccgccgttgattatgttggtgatcacgccgta 29262
>gb|AW560048.1|AW560048 EST315096 DSIR Medicago truncatula cDNA clone pDSIR-26G13, mRNA
sequence
Length = 738
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 715 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 669
>gb|AL382691.1|AL382691 MtBC09D09F1 MtBC Medicago truncatula cDNA clone MtBC09D09 T3, mRNA
sequence
Length = 482
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 169 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 123
>gb|BE942180.1|BE942180 EST421759 MGHG Medicago truncatula cDNA clone pMGHG-7B24, mRNA
sequence
Length = 400
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 72 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 26
>gb|BE943303.1|BE943303 EST422882 MGHG Medicago truncatula cDNA clone pMGHG-15I16, mRNA
sequence
Length = 583
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 160 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 114
>gb|BE997567.1|BE997567 EST429290 GVSN Medicago truncatula cDNA clone pGVSN-1B17, mRNA
sequence
Length = 493
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 390 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 344
>gb|BE997667.1|BE997667 EST429390 GVSN Medicago truncatula cDNA clone pGVSN-1F10, mRNA
sequence
Length = 471
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 143 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 97
>gb|BF637904.1|BF637904 NF029F08PL1F1073 Phosphate starved leaf Medicago truncatula cDNA
clone NF029F08PL 5', mRNA sequence
Length = 642
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 560 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 514
>gb|BF638282.1|BF638282 NF053C09PL1F1068 Phosphate starved leaf Medicago truncatula cDNA
clone NF053C09PL 5', mRNA sequence
Length = 649
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 560 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 514
>gb|BF650277.1|BF650277 NF087B10EC1F1079 Elicited cell culture Medicago truncatula cDNA
clone NF087B10EC 5', mRNA sequence
Length = 610
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 563 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 517
>gb|AW687771.2|AW687771 NF013C08RT1F1065 Developing root Medicago truncatula cDNA clone
NF013C08RT 5', mRNA sequence
Length = 584
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 378 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 332
>gb|BQ152522.1|BQ152522 NF019F07IR1F1061 Irradiated Medicago truncatula cDNA clone
NF019F07IR 5', mRNA sequence
Length = 540
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 175 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 129
>gb|BQ155216.1|BQ155216 NF077E04IR1F1035 Irradiated Medicago truncatula cDNA clone
NF077E04IR 5', mRNA sequence
Length = 396
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 372 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 326
>gb|BQ157165.1|BQ157165 NF101F12IR1F1103 Irradiated Medicago truncatula cDNA clone
NF101F12IR 5', mRNA sequence
Length = 616
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 170 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 124
>gb|BQ165427.1|BQ165427 EST611296 KVKC Medicago truncatula cDNA clone pKVKC-9B4, mRNA
sequence
Length = 767
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 731 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 685
>gb|BQ165428.1|BQ165428 EST611297 KVKC Medicago truncatula cDNA clone pKVKC-9B4, mRNA
sequence
Length = 739
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 424 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 470
>gb|CB892183.1|CB892183 EST649152 KV3 Medicago truncatula cDNA clone KV3-53O18, mRNA
sequence
Length = 811
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 700 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 654
>gb|CB893707.1|CB893707 EST646499 HOGA Medicago truncatula cDNA clone HOGA-28D4, mRNA
sequence
Length = 810
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 632 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 586
>gb|CB893753.1|CB893753 EST646545 HOGA Medicago truncatula cDNA clone HOGA-28L14, mRNA
sequence
Length = 783
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 634 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 588
>gb|CB895070.1|CB895070 EST647862 HOGA Medicago truncatula cDNA clone HOGA-33B21, mRNA
sequence
Length = 532
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 390 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 344
>gb|AJ500330.1|AJ500330 AJ500330 MTGIM Medicago truncatula cDNA clone mtgmacc120015c02,
mRNA sequence
Length = 493
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 425 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 379
>gb|CX531641.1|CX531641 s13dNF80C04MJ022_257227 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 609
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 424 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 470
>gb|AC121239.34| Medicago truncatula clone mth1-8p19, complete sequence
Length = 100985
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 89350 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 89396
>emb|Y10373.1|MTCHITIN1 M.truncatula mRNA for chitinase
Length = 1315
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Minus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 743 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 697
>emb|CT025534.4| M.truncatula DNA sequence from clone MTH2-1H4 on chromosome 3, complete
sequence
Length = 100991
Score = 46.1 bits (23), Expect = 0.007
Identities = 41/47 (87%)
Strand = Plus / Plus
Query: 371 acgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 417
||||| ||||| || ||||| || ||||| |||||||||||||||||
Sbjct: 89347 acgtcatggcaggatggcttaggtgactggggcgtcatccagaacca 89393
>gb|AW560047.1|AW560047 EST315095 DSIR Medicago truncatula cDNA clone pDSIR-26G13, mRNA
sequence
Length = 629
Score = 40.1 bits (20), Expect = 0.40
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 386 ggcttgggcgactgcggcgtcatccagaacca 417
||||| || ||||| |||||||||||||||||
Sbjct: 623 ggcttaggtgactggggcgtcatccagaacca 592
>gb|CA858965.1|CA858965 EST636220 GLSD Medicago truncatula cDNA clone pGLSD-39H17, mRNA
sequence
Length = 738
Score = 40.1 bits (20), Expect = 0.40
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 281 ccgccgttgatgatgttggtgacgacgccgta 312
||||||||||| |||||||||| ||||||||
Sbjct: 735 ccgccgttgattatgttggtgatcacgccgta 704
>gb|AC140032.4| Medicago truncatula clone mth2-10i23, complete sequence
Length = 124302
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 18 atttgctttattcttgattg 37
||||||||||||||||||||
Sbjct: 89371 atttgctttattcttgattg 89352
>gb|AC150203.13| Medicago truncatula clone mth2-65b23, complete sequence
Length = 92476
Score = 40.1 bits (20), Expect = 0.40
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 18 atttgctttattcttgattg 37
||||||||||||||||||||
Sbjct: 86927 atttgctttattcttgattg 86946
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 127,380
Number of Sequences: 392609
Number of extensions: 127380
Number of successful extensions: 9321
Number of sequences better than 0.5: 44
Number of HSP's better than 0.5 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 9265
Number of HSP's gapped (non-prelim): 56
length of query: 1141
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1121
effective length of database: 433,880,813
effective search space: 486380391373
effective search space used: 486380391373
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)