BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3642920.2.1
         (570 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC150844.30|  Medicago truncatula clone mth2-104a5, WORKI...    64   1e-008
gb|DW019011.1|DW019011  EST1227972 MTY Medicago truncatula c...    44   0.013
gb|AC138133.26|  Medicago truncatula clone mth2-9o2, complet...    42   0.050
gb|AC149496.20|  Medicago truncatula clone mth2-119c5, compl...    42   0.050
gb|CG930164.1|CG930164  MBEIW34TR mth2 Medicago truncatula g...    40   0.20 
gb|CG939602.1|CG939602  MBELA01TF mth2 Medicago truncatula g...    40   0.20 
gb|BG581102.1|BG581102  EST482832 GVN Medicago truncatula cD...    40   0.20 

>gb|AC150844.30| Medicago truncatula clone mth2-104a5, WORKING DRAFT SEQUENCE, 7 ordered
             pieces
          Length = 137420

 Score = 63.9 bits (32), Expect = 1e-008
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                         
Query: 165   cctgctattgttgaggtgaaaggtgttcatcaatttgattggttaacacaagaaaatgtt 224
             |||||||||||||| || |||||  ||||||| ||||| ||||||||   ||||||||||
Sbjct: 42275 cctgctattgttgaagtcaaaggcattcatcagtttgactggttaactagagaaaatgtt 42216

                         
Query: 225   cctgtacttgaa 236
             || |||||||||
Sbjct: 42215 ccggtacttgaa 42204



>gb|DW019011.1|DW019011 EST1227972 MTY Medicago truncatula cDNA clone MTYBD75, mRNA
           sequence
          Length = 200

 Score = 44.1 bits (22), Expect = 0.013
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 215 agaaaatgttcctgtacttgaa 236
           ||||||||||||||||||||||
Sbjct: 132 agaaaatgttcctgtacttgaa 153



>gb|AC138133.26| Medicago truncatula clone mth2-9o2, complete sequence
          Length = 149166

 Score = 42.1 bits (21), Expect = 0.050
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 197   atttgattggttaacacaaga 217
             |||||||||||||||||||||
Sbjct: 46590 atttgattggttaacacaaga 46570



>gb|AC149496.20| Medicago truncatula clone mth2-119c5, complete sequence
          Length = 115576

 Score = 42.1 bits (21), Expect = 0.050
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 197   atttgattggttaacacaaga 217
             |||||||||||||||||||||
Sbjct: 98456 atttgattggttaacacaaga 98436



>gb|CG930164.1|CG930164 MBEIW34TR mth2 Medicago truncatula genomic clone 65F19, DNA
           sequence
          Length = 910

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 47/56 (83%)
 Strand = Plus / Plus

                                                                   
Query: 489 aaggttaatggcgctgttgagacttgcagaggtggagatagttgggtgatgtctaa 544
           ||||| |||||||| || || ||||||||||| | ||||  |||||| ||||||||
Sbjct: 770 aaggtaaatggcgccgtggaaacttgcagaggggaagatgattgggtaatgtctaa 825



>gb|CG939602.1|CG939602 MBELA01TF mth2 Medicago truncatula genomic clone 78A1, DNA sequence
          Length = 914

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 485 tgggaaggttaatggcgctgttgagacttgca 516
           |||||| |||||||| ||||||||||| ||||
Sbjct: 567 tgggaatgttaatggagctgttgagacatgca 598



>gb|BG581102.1|BG581102 EST482832 GVN Medicago truncatula cDNA clone pGVN-63F8 5' end, mRNA
           sequence
          Length = 593

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 485 tgggaaggttaatggcgctgttgagacttgca 516
           |||||| |||||||| ||||||||||| ||||
Sbjct: 84  tgggaatgttaatggagctgttgagacatgca 115



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 199,043
Number of Sequences: 392609
Number of extensions: 199043
Number of successful extensions: 15150
Number of sequences better than  0.5: 7
Number of HSP's better than  0.5 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 15133
Number of HSP's gapped (non-prelim): 17
length of query: 570
length of database: 441,732,993
effective HSP length: 19
effective length of query: 551
effective length of database: 434,273,422
effective search space: 239284655522
effective search space used: 239284655522
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)