BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3198841.2.2
(602 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AL386312.1|AL386312 MtBC33H06F1 MtBC Medicago truncatula... 60 2e-007
gb|CX531134.1|CX531134 s13dNF22C09MJ067_248398 Methyl Jasmo... 60 2e-007
gb|BG645485.1|BG645485 EST507104 KV3 Medicago truncatula cD... 54 1e-005
gb|CG944398.1|CG944398 MBEBI73TR mth2 Medicago truncatula g... 52 5e-005
gb|BG646762.1|BG646762 EST508381 HOGA Medicago truncatula c... 46 0.003
emb|CR498011.1| mth2-174A12FM1 BAC end, cultivar Jemalong A... 40 0.21
emb|CR510536.1| mth4-22G16RM1 BAC end, cultivar Jemalong A1... 40 0.21
gb|BE203128.1|BE203128 EST403150 KV1 Medicago truncatula cD... 40 0.21
gb|AL389737.1|AL389737 MtBC57B02F1 MtBC Medicago truncatula... 40 0.21
gb|BF521396.1|BF521396 EST458872 DSIL Medicago truncatula c... 40 0.21
gb|BF637447.1|BF637447 NF025C05PL1F1036 Phosphate starved l... 40 0.21
gb|BF645036.1|BF645036 NF032A05EC1F1036 Elicited cell cultu... 40 0.21
gb|BF648606.1|BF648606 NF049E11EC1F1086 Elicited cell cultu... 40 0.21
gb|BF650715.1|BF650715 NF095H02EC1F1026 Elicited cell cultu... 40 0.21
gb|BG450734.1|BG450734 NF111D02DT1F1016 Drought Medicago tr... 40 0.21
gb|BG453707.1|BG453707 NF100E09LF1F1068 Developing leaf Med... 40 0.21
gb|BG453839.1|BG453839 NF095C07LF1F1051 Developing leaf Med... 40 0.21
gb|BG457457.1|BG457457 NF104A03PL1F1019 Phosphate starved l... 40 0.21
gb|BI308421.1|BI308421 EST529831 GPOD Medicago truncatula c... 40 0.21
gb|BQ124710.1|BQ124710 EST610286 GLSD Medicago truncatula c... 40 0.21
gb|BQ136916.1|BQ136916 NF021B06ST1F1000 Developing stem Med... 40 0.21
gb|AJ503340.1|AJ503340 AJ503340 MTAMP Medicago truncatula c... 40 0.21
gb|CA917314.1|CA917314 EST641461 GPOD Medicago truncatula c... 40 0.21
gb|CA990600.1|CA990600 EST644108 GESD Medicago truncatula c... 40 0.21
gb|CX526474.1|CX526474 s13dNF46C04AT034_510692 Aphid-Infect... 40 0.21
gb|CX532491.1|CX532491 s13dNF66F03MJ027_271271 Methyl Jasmo... 40 0.21
gb|AC130799.19| Medicago truncatula clone mth2-34b13, compl... 40 0.21
gb|AC144723.5| Medicago truncatula clone mth2-7h1, WORKING ... 40 0.21
gb|AC146719.32| Medicago truncatula clone mth2-17f11, compl... 40 0.21
>gb|AL386312.1|AL386312 MtBC33H06F1 MtBC Medicago truncatula cDNA clone MtBC33H06 T3, mRNA
sequence
Length = 498
Score = 60.0 bits (30), Expect = 2e-007
Identities = 81/98 (82%)
Strand = Plus / Plus
Query: 432 aattgcggtgtttgcatggggaagtacttctgtggtttgtgcaaactcttcgacgatgat 491
||||| |||||||||||||| |||||||| |||| | ||||| |||| ||||||||||
Sbjct: 332 aattgtggtgtttgcatgggcaagtacttttgtgatacatgcaagctctacgacgatgat 391
Query: 492 gtctctaaacagcagtatcactgcaacggatgtggaat 529
| ||||| |||||||| || || || || ||||||||
Sbjct: 392 atatctaagcagcagtaccattgtaatggctgtggaat 429
Score = 44.1 bits (22), Expect = 0.013
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 276 tgcaatgaaatttttgattgccgacactgccacaatga 313
|||||||| |||||||||||||| || || ||||||||
Sbjct: 176 tgcaatgagatttttgattgccgccattgtcacaatga 213
>gb|CX531134.1|CX531134 s13dNF22C09MJ067_248398 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 408
Score = 60.0 bits (30), Expect = 2e-007
Identities = 81/98 (82%)
Strand = Plus / Plus
Query: 432 aattgcggtgtttgcatggggaagtacttctgtggtttgtgcaaactcttcgacgatgat 491
||||| |||||||||||||| |||||||| |||| | ||||| |||| ||||||||||
Sbjct: 178 aattgtggtgtttgcatgggcaagtacttttgtgatacatgcaagctctacgacgatgat 237
Query: 492 gtctctaaacagcagtatcactgcaacggatgtggaat 529
| ||||| |||||||| || || || || ||||||||
Sbjct: 238 atatctaagcagcagtaccattgtaatggctgtggaat 275
>gb|BG645485.1|BG645485 EST507104 KV3 Medicago truncatula cDNA clone pKV3-46K14 5' end,
mRNA sequence
Length = 814
Score = 54.0 bits (27), Expect = 1e-005
Identities = 42/47 (89%)
Strand = Plus / Plus
Query: 267 gctccttgctgcaatgaaatttttgattgccgacactgccacaatga 313
|||||||| |||||||| |||||||||||||| || || ||||||||
Sbjct: 597 gctccttgttgcaatgagatttttgattgccgccattgtcacaatga 643
Score = 40.1 bits (20), Expect = 0.21
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 438 ggtgtttgcatggggaagtacttctgtg 465
|||||||| ||||| |||||||||||||
Sbjct: 769 ggtgtttgtatgggcaagtacttctgtg 796
>gb|CG944398.1|CG944398 MBEBI73TR mth2 Medicago truncatula genomic clone 19M1, DNA sequence
Length = 889
Score = 52.0 bits (26), Expect = 5e-005
Identities = 53/62 (85%)
Strand = Plus / Plus
Query: 432 aattgcggtgtttgcatggggaagtacttctgtggtttgtgcaaactcttcgacgatgat 491
||||| |||||||||||||| |||||||| |||| | ||||| |||| ||||||||||
Sbjct: 157 aattgtggtgtttgcatgggcaagtacttttgtgatacatgcaagctctacgacgatgat 216
Query: 492 gt 493
||
Sbjct: 217 gt 218
>gb|BG646762.1|BG646762 EST508381 HOGA Medicago truncatula cDNA clone pHOGA-9B12 5' end,
mRNA sequence
Length = 669
Score = 46.1 bits (23), Expect = 0.003
Identities = 53/63 (84%)
Strand = Plus / Plus
Query: 276 tgcaatgaaatttttgattgccgacactgccacaatgaaactaagaattccattaaaatt 335
|||||||||||||| |||||| |||| ||||| || ||| | |||||||| ||| || ||
Sbjct: 85 tgcaatgaaattttcgattgcagacattgccataacgaatccaagaattcgattcaagtt 144
Query: 336 gat 338
|||
Sbjct: 145 gat 147
>emb|CR498011.1| mth2-174A12FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 382
Score = 40.1 bits (20), Expect = 0.21
Identities = 47/56 (83%)
Strand = Plus / Plus
Query: 438 ggtgtttgcatggggaagtacttctgtggtttgtgcaaactcttcgacgatgatgt 493
|||||||| ||||| ||||||||||||| ||||| ||||| |||||||||||
Sbjct: 267 ggtgtttgtatgggcaagtacttctgtgagacatgcaagctctttgacgatgatgt 322
>emb|CR510536.1| mth4-22G16RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 655
Score = 40.1 bits (20), Expect = 0.21
Identities = 47/56 (83%)
Strand = Plus / Plus
Query: 438 ggtgtttgcatggggaagtacttctgtggtttgtgcaaactcttcgacgatgatgt 493
|||||||| ||||| ||||||||||||| ||||| ||||| |||||||||||
Sbjct: 266 ggtgtttgtatgggcaagtacttctgtgagacatgcaagctctttgacgatgatgt 321
>gb|BE203128.1|BE203128 EST403150 KV1 Medicago truncatula cDNA clone pKV1-4B1, mRNA
sequence
Length = 565
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 495 tgtatcaattgcggcgtgtgcatgggcaagta 526
>gb|AL389737.1|AL389737 MtBC57B02F1 MtBC Medicago truncatula cDNA clone MtBC57B02 T3, mRNA
sequence
Length = 497
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 153 tgtatcaattgcggcgtgtgcatgggcaagta 184
>gb|BF521396.1|BF521396 EST458872 DSIL Medicago truncatula cDNA clone pDSIL-43C16, mRNA
sequence
Length = 710
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 233 tgtatcaattgcggcgtgtgcatgggcaagta 264
>gb|BF637447.1|BF637447 NF025C05PL1F1036 Phosphate starved leaf Medicago truncatula cDNA
clone NF025C05PL 5', mRNA sequence
Length = 663
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 509 tgtatcaattgcggcgtgtgcatgggcaagta 540
>gb|BF645036.1|BF645036 NF032A05EC1F1036 Elicited cell culture Medicago truncatula cDNA
clone NF032A05EC 5', mRNA sequence
Length = 650
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 516 tgtatcaattgcggcgtgtgcatgggcaagta 547
>gb|BF648606.1|BF648606 NF049E11EC1F1086 Elicited cell culture Medicago truncatula cDNA
clone NF049E11EC 5', mRNA sequence
Length = 651
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 517 tgtatcaattgcggcgtgtgcatgggcaagta 548
>gb|BF650715.1|BF650715 NF095H02EC1F1026 Elicited cell culture Medicago truncatula cDNA
clone NF095H02EC 5', mRNA sequence
Length = 580
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 516 tgtatcaattgcggcgtgtgcatgggcaagta 547
>gb|BG450734.1|BG450734 NF111D02DT1F1016 Drought Medicago truncatula cDNA clone NF111D02DT
5', mRNA sequence
Length = 670
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 516 tgtatcaattgcggcgtgtgcatgggcaagta 547
>gb|BG453707.1|BG453707 NF100E09LF1F1068 Developing leaf Medicago truncatula cDNA clone
NF100E09LF 5', mRNA sequence
Length = 644
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 13 tgtatcaattgcggcgtgtgcatgggcaagta 44
>gb|BG453839.1|BG453839 NF095C07LF1F1051 Developing leaf Medicago truncatula cDNA clone
NF095C07LF 5', mRNA sequence
Length = 596
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 512 tgtatcaattgcggcgtgtgcatgggcaagta 543
>gb|BG457457.1|BG457457 NF104A03PL1F1019 Phosphate starved leaf Medicago truncatula cDNA
clone NF104A03PL 5', mRNA sequence
Length = 639
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 511 tgtatcaattgcggcgtgtgcatgggcaagta 542
>gb|BI308421.1|BI308421 EST529831 GPOD Medicago truncatula cDNA clone pGPOD-5F8 5' end,
mRNA sequence
Length = 775
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 516 tgtatcaattgcggcgtgtgcatgggcaagta 547
>gb|BQ124710.1|BQ124710 EST610286 GLSD Medicago truncatula cDNA clone pGLSD-37C17, mRNA
sequence
Length = 699
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 226 tgtatcaattgcggcgtgtgcatgggcaagta 257
>gb|BQ136916.1|BQ136916 NF021B06ST1F1000 Developing stem Medicago truncatula cDNA clone
NF021B06ST 5', mRNA sequence
Length = 788
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 621 tgtatcaattgcggcgtgtgcatgggcaagta 652
>gb|AJ503340.1|AJ503340 AJ503340 MTAMP Medicago truncatula cDNA clone mtgmadc120032h07,
mRNA sequence
Length = 600
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 524 tgtatcaattgcggcgtgtgcatgggcaagta 555
>gb|CA917314.1|CA917314 EST641461 GPOD Medicago truncatula cDNA clone GPOD-35D22, mRNA
sequence
Length = 647
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 506 tgtatcaattgcggcgtgtgcatgggcaagta 537
>gb|CA990600.1|CA990600 EST644108 GESD Medicago truncatula cDNA clone GESD-29A20, mRNA
sequence
Length = 587
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 446 tgtatcaattgcggcgtgtgcatgggcaagta 477
>gb|CX526474.1|CX526474 s13dNF46C04AT034_510692 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 635
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 515 tgtatcaattgcggcgtgtgcatgggcaagta 546
>gb|CX532491.1|CX532491 s13dNF66F03MJ027_271271 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 656
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 514 tgtatcaattgcggcgtgtgcatgggcaagta 545
>gb|AC130799.19| Medicago truncatula clone mth2-34b13, complete sequence
Length = 133305
Score = 40.1 bits (20), Expect = 0.21
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 426 tgtatcaattgcggtgtttgcatggggaagta 457
|||||||||||||| || |||||||| |||||
Sbjct: 112298 tgtatcaattgcggcgtgtgcatgggcaagta 112267
>gb|AC144723.5| Medicago truncatula clone mth2-7h1, WORKING DRAFT SEQUENCE, 18
unordered pieces
Length = 64100
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 308 caatgaaactaagaattcca 327
||||||||||||||||||||
Sbjct: 31751 caatgaaactaagaattcca 31770
>gb|AC146719.32| Medicago truncatula clone mth2-17f11, complete sequence
Length = 127364
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 200 tgagaaatttgagaaaggga 219
||||||||||||||||||||
Sbjct: 117266 tgagaaatttgagaaaggga 117247
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 169,789
Number of Sequences: 392609
Number of extensions: 169789
Number of successful extensions: 11990
Number of sequences better than 0.5: 29
Number of HSP's better than 0.5 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11931
Number of HSP's gapped (non-prelim): 59
length of query: 602
length of database: 441,732,993
effective HSP length: 19
effective length of query: 583
effective length of database: 434,273,422
effective search space: 253181405026
effective search space used: 253181405026
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)