BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3191506.2.1
(1208 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BI271827.1|BI271827 NF012D10FL1F1089 Developing flower M... 141 2e-031
gb|AC147014.24| Medicago truncatula clone mth2-164l15, WORK... 135 1e-029
gb|BI273080.1|BI273080 NF099E10FL1F1082 Developing flower M... 62 1e-007
gb|BI309958.1|BI309958 EST5311708 GESD Medicago truncatula ... 60 5e-007
gb|CG942288.1|CG942288 MBENQ51TR mth2 Medicago truncatula g... 54 3e-005
gb|BF647920.1|BF647920 NF038E03EC1F1022 Elicited cell cultu... 54 3e-005
gb|AC161399.2| Medicago truncatula chromosome 2 BAC clone m... 54 3e-005
gb|AJ500111.1|AJ500111 AJ500111 MTGIM Medicago truncatula c... 46 0.007
gb|AJ500539.1|AJ500539 AJ500539 MTGIM Medicago truncatula c... 46 0.007
gb|AJ499470.1|AJ499470 AJ499470 MTGIM Medicago truncatula c... 46 0.007
gb|BE203691.1|BE203691 EST396367 KV0 Medicago truncatula cD... 44 0.027
gb|CX535046.1|CX535046 s13dNF36C06MJ050_388273 Methyl Jasmo... 44 0.027
gb|BG645289.1|BG645289 EST506908 KV3 Medicago truncatula cD... 42 0.11
gb|AJ500181.1|AJ500181 AJ500181 MTGIM Medicago truncatula c... 42 0.11
gb|AJ500456.1|AJ500456 AJ500456 MTGIM Medicago truncatula c... 42 0.11
gb|AJ499175.1|AJ499175 AJ499175 MTGIM Medicago truncatula c... 42 0.11
gb|CA917455.1|CA917455 EST641602 GPOD Medicago truncatula c... 40 0.43
gb|AJ500088.1|AJ500088 AJ500088 MTGIM Medicago truncatula c... 40 0.43
gb|AJ500185.1|AJ500185 AJ500185 MTGIM Medicago truncatula c... 40 0.43
gb|AJ500217.1|AJ500217 AJ500217 MTGIM Medicago truncatula c... 40 0.43
gb|AJ500301.1|AJ500301 AJ500301 MTGIM Medicago truncatula c... 40 0.43
gb|AJ500566.1|AJ500566 AJ500566 MTGIM Medicago truncatula c... 40 0.43
gb|AJ500711.1|AJ500711 AJ500711 MTGIM Medicago truncatula c... 40 0.43
gb|AJ621860.1|AJ621860 AJ621860 Medicago truncatula J5 root... 40 0.43
gb|AJ864417.1|AJ864417 AJ864417 Medicago truncatula cv. J5 ... 40 0.43
gb|AC151665.22| Medicago truncatula clone mth2-7k4, WORKING... 40 0.43
gb|AC174354.3| Medicago truncatula clone mth2-8m12, WORKING... 40 0.43
>gb|BI271827.1|BI271827 NF012D10FL1F1089 Developing flower Medicago truncatula cDNA clone
NF012D10FL 5', mRNA sequence
Length = 685
Score = 141 bits (71), Expect = 2e-031
Identities = 323/407 (79%)
Strand = Plus / Plus
Query: 750 aaactgaactttggggccatgaacatgtggtttttgctgaatccacctggggatgcaaca 809
||||| || ||||| |||||||||||||||||| | |||| || ||||| | || |||
Sbjct: 3 aaactcaattttggagccatgaacatgtggtttcttttgaaccctcctggaaaagctaca 62
Query: 810 atccatgtggaaaatgttgatgacttcaaatggttaaactcttcttactgccctgttctg 869
|||||||| ||||||| ||||| || || ||||| ||||| || ||||||||||| ||
Sbjct: 63 atccatgttcaaaatgtagatgattttaagtggttgaactcatcctactgccctgtattg 122
Query: 870 aagcagcttgagtctgcagccatgaaagaatattatttcaaggctgatcgtccgaaaaca 929
||||||||| |||||| |||||||| |||||||||||||| | | ||| | ||
Sbjct: 123 cggcagcttgaatctgcaaaaatgaaagagtattatttcaaggcaggccatccaaccact 182
Query: 930 ctctctgctggttcttctaatctgaagtatcgaaacccaaaatatttgtccatgctcaat 989
|| ||| ||||| |||| ||| |||| ||| |||||||||||||| | || ||||||||
Sbjct: 183 ctttcttctggtgcttccaatatgaaatatagaaacccaaaatatctctcgatgctcaac 242
Query: 990 catctaagattttacctcccacaagtctatcccaagctgaataaaattcttttcctggat 1049
||||| ||||| || || ||| |||| ||||| || | ||||||| ||||| || |||
Sbjct: 243 catcttagattctatcttccagaagtttatcctaaattagataaaatcctttttcttgat 302
Query: 1050 gatgatatagttgtccagagggacctaactggactctgggaggttgatcttaatggaaat 1109
||||| || ||||| |||| ||| | || ||| | ||||| ||||||||| | || ||
Sbjct: 303 gatgacatcgttgttcagaaggatttgacaggattatgggaagttgatcttcaggggaaa 362
Query: 1110 gtaaatggagccgtggaaacatgtggagagagttttcaccgatttga 1156
|||||||| || || ||||||||||| || || ||||||||||||||
Sbjct: 363 gtaaatggtgcagttgaaacatgtggtgaaagctttcaccgatttga 409
>gb|AC147014.24| Medicago truncatula clone mth2-164l15, WORKING DRAFT SEQUENCE
Length = 127679
Score = 135 bits (68), Expect = 1e-029
Identities = 158/188 (84%)
Strand = Plus / Minus
Query: 726 catgtatttcatcttgttactgacaaactgaactttggggccatgaacatgtggtttttg 785
||||| ||||| |||||||| || ||||| || ||||| ||||||||||||||||||||
Sbjct: 87699 catgtgtttcaccttgttaccgataaactaaattttggagccatgaacatgtggttttta 87640
Query: 786 ctgaatccacctggggatgcaacaatccatgtggaaaatgttgatgacttcaaatggtta 845
||||||| |||||| | || |||||| |||| |||||||||||||| || || |||||
Sbjct: 87639 ttgaatcctcctgggaaagctacaatctatgttgaaaatgttgatgaatttaagtggttg 87580
Query: 846 aactcttcttactgccctgttctgaagcagcttgagtctgcagccatgaaagaatattat 905
||||| ||||||||||| || ||| ||||||||||||| | |||||||| ||||||
Sbjct: 87579 aactcatcttactgcccagtcttgagacagcttgagtctgtgacaatgaaagagtattat 87520
Query: 906 ttcaaggc 913
||||||||
Sbjct: 87519 ttcaaggc 87512
Score = 73.8 bits (37), Expect = 3e-011
Identities = 172/217 (79%)
Strand = Plus / Minus
Query: 937 ctggttcttctaatctgaagtatcgaaacccaaaatatttgtccatgctcaatcatctaa 996
||||| |||||||||| || || |||| ||||||||| | || ||||||||||| | |
Sbjct: 87494 ctggtgcttctaatctcaaatacagaaatccaaaatatctttcaatgctcaatcacttga 87435
Query: 997 gattttacctcccacaagtctatcccaagctgaataaaattcttttcctggatgatgata 1056
| || || || |||||||| ||||| || || |||| |||||||| || |||||||| |
Sbjct: 87434 ggttctatcttccacaagtttatccaaaattggataagattctttttcttgatgatgaca 87375
Query: 1057 tagttgtccagagggacctaactggactctgggaggttgatcttaatggaaatgtaaatg 1116
| ||||| |||| ||| | |||||| | ||| | || |||||| ||||||| || || |
Sbjct: 87374 ttgttgttcagaaggatttgactggattatggaatgtggatcttcatggaaaagttaacg 87315
Query: 1117 gagccgtggaaacatgtggagagagttttcaccgatt 1153
| || || ||||||||||| ||||| |||||||||||
Sbjct: 87314 gtgcagttgaaacatgtggtgagagctttcaccgatt 87278
Score = 69.9 bits (35), Expect = 5e-010
Identities = 56/63 (88%)
Strand = Plus / Minus
Query: 635 tctttaccattatgctcttttctcggacaatgttttggcagcatcagttgtggtcaactc 694
|||||| |||||||| || ||||| |||||||||||||| ||||| ||||| ||||||||
Sbjct: 87984 tctttatcattatgccctattctcagacaatgttttggctgcatctgttgtcgtcaactc 87925
Query: 695 aac 697
|||
Sbjct: 87924 aac 87922
>gb|BI273080.1|BI273080 NF099E10FL1F1082 Developing flower Medicago truncatula cDNA clone
NF099E10FL 5', mRNA sequence
Length = 668
Score = 61.9 bits (31), Expect = 1e-007
Identities = 187/239 (78%)
Strand = Plus / Plus
Query: 441 ttgagagcaatgcttcagtcagcagatgagcaggtccggagcttgaagaagcagagcacc 500
|||||||||||||| ||| |||| |||||||| || ||| ||||||||| || |||||
Sbjct: 299 ttgagagcaatgctacagacagctgatgagcaagttaggaacttgaagaaacaaagcaca 358
Query: 501 ttccttagccagctagcagctaagacaatcccaaatggcatccattgtctttccatgcgc 560
||||| || ||| | || |||||||| || |||| ||| || ||||| | || ||||||
Sbjct: 359 ttcctcagtcagttggctgctaagaccataccaagtggaattcattgcttatctatgcgc 418
Query: 561 ttaacgattgattattatcttctctctccagagaaaagaaagttcccaaatagtgagaac 620
| || || ||||| || || || |||| || ||||| |||||||| | || ||||||
Sbjct: 419 ctcacaatagattactacctccttcctcctgaaaaaaggaagttccctaggagcgagaac 478
Query: 621 ctggaaaatcctgatctttaccattatgctcttttctcggacaatgttttggcagcatc 679
|||| ||||| |||||| |||||||| || || || |||||||| ||||| |||||
Sbjct: 479 ttggagaatcccagtctttatcattatgcactattttcagacaatgtcttggctgcatc 537
Score = 58.0 bits (29), Expect = 2e-006
Identities = 41/45 (91%)
Strand = Plus / Plus
Query: 738 cttgttactgacaaactgaactttggggccatgaacatgtggttt 782
||||||||||| ||||| || ||||| ||||||||||||||||||
Sbjct: 598 cttgttactgataaactcaattttggagccatgaacatgtggttt 642
>gb|BI309958.1|BI309958 EST5311708 GESD Medicago truncatula cDNA clone pGESD4L15 5' end, mRNA
sequence
Length = 731
Score = 60.0 bits (30), Expect = 5e-007
Identities = 117/146 (80%)
Strand = Plus / Plus
Query: 1008 ccacaagtctatcccaagctgaataaaattcttttcctggatgatgatatagttgtccag 1067
|||||||| ||||| || || |||| |||||||| || |||||||| || ||||| |||
Sbjct: 35 ccacaagtttatccaaaattggataagattctttttcttgatgatgacattgttgttcag 94
Query: 1068 agggacctaactggactctgggaggttgatcttaatggaaatgtaaatggagccgtggaa 1127
| ||| | |||||| | ||| | || |||||| ||||||| || || || || || |||
Sbjct: 95 aaggatttgactggattatggaatgtggatcttcatggaaaagttaacggtgcagttgaa 154
Query: 1128 acatgtggagagagttttcaccgatt 1153
|||||||| ||||| |||||||||||
Sbjct: 155 acatgtggtgagagctttcaccgatt 180
>gb|CG942288.1|CG942288 MBENQ51TR mth2 Medicago truncatula genomic clone 10I5, DNA sequence
Length = 942
Score = 54.0 bits (27), Expect = 3e-005
Identities = 111/139 (79%)
Strand = Plus / Plus
Query: 930 ctctctgctggttcttctaatctgaagtatcgaaacccaaaatatttgtccatgctcaat 989
||||||||||||||| ||||| || ||| |||| || ||||||||||| ||||| |||
Sbjct: 784 ctctctgctggttctgacaatctaaaatatagaaatcccaaatatttgtcaatgctgaat 843
Query: 990 catctaagattttacctcccacaagtctatcccaagctgaataaaattcttttcctggat 1049
|| |||| || ||||| || |||| ||||| || || | |||||||| ||| |||||
Sbjct: 844 cacttaaggttctaccttcctgaagtttatccaaaattggacaaaattctattcttggat 903
Query: 1050 gatgatatagttgtccaga 1068
||||| || ||||| ||||
Sbjct: 904 gatgacattgttgtgcaga 922
>gb|BF647920.1|BF647920 NF038E03EC1F1022 Elicited cell culture Medicago truncatula cDNA
clone NF038E03EC 5', mRNA sequence
Length = 652
Score = 54.0 bits (27), Expect = 3e-005
Identities = 87/107 (81%)
Strand = Plus / Plus
Query: 441 ttgagagcaatgcttcagtcagcagatgagcaggtccggagcttgaagaagcagagcacc 500
|||||||||||||| ||| |||| |||||||| || ||| ||||||||| || |||||
Sbjct: 466 ttgagagcaatgctacagacagctgatgagcaagttaggaacttgaagaaacaaagcaca 525
Query: 501 ttccttagccagctagcagctaagacaatcccaaatggcatccattg 547
||||| || ||| | || |||||||| || |||| ||| || |||||
Sbjct: 526 ttcctcagtcagttggctgctaagaccataccaagtggaattcattg 572
Score = 52.0 bits (26), Expect = 1e-004
Identities = 62/74 (83%)
Strand = Plus / Plus
Query: 90 aaacttgagaatgcaggtatcgaacgttcaaaagctgttgactctgctgtgctgggaaaa 149
|||||||| |||| || ||| |||||||||| | ||||||| || || || ||||| |||
Sbjct: 115 aaacttgaaaatgaagctattgaacgttcaagatctgttgagtcagccgtactgggtaaa 174
Query: 150 tacagcatctggag 163
|||||||| |||||
Sbjct: 175 tacagcatttggag 188
>gb|AC161399.2| Medicago truncatula chromosome 2 BAC clone mte1-30k4, complete sequence
Length = 172016
Score = 54.0 bits (27), Expect = 3e-005
Identities = 45/51 (88%)
Strand = Plus / Minus
Query: 1107 aatgtaaatggagccgtggaaacatgtggagagagttttcaccgatttgat 1157
|||||||||||||| || ||||| |||||||| ||||| || |||||||||
Sbjct: 52827 aatgtaaatggagctgtagaaacttgtggagaaagtttccatcgatttgat 52777
>gb|AJ500111.1|AJ500111 AJ500111 MTGIM Medicago truncatula cDNA clone mtgmacc120012g12, mRNA
sequence
Length = 398
Score = 46.1 bits (23), Expect = 0.007
Identities = 23/23 (100%)
Strand = Plus / Plus
Query: 1185 ccgcgtacctgcccgggcggccg 1207
|||||||||||||||||||||||
Sbjct: 375 ccgcgtacctgcccgggcggccg 397
>gb|AJ500539.1|AJ500539 AJ500539 MTGIM Medicago truncatula cDNA clone mtgmacc120017e07, mRNA
sequence
Length = 489
Score = 46.1 bits (23), Expect = 0.007
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1185 ccgcgtacctgcccgggcggccg 1207
|||||||||||||||||||||||
Sbjct: 26 ccgcgtacctgcccgggcggccg 4
>gb|AJ499470.1|AJ499470 AJ499470 MTGIM Medicago truncatula cDNA clone mtgmacc120004f05, mRNA
sequence
Length = 128
Score = 46.1 bits (23), Expect = 0.007
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 1185 ccgcgtacctgcccgggcggccg 1207
|||||||||||||||||||||||
Sbjct: 28 ccgcgtacctgcccgggcggccg 6
>gb|BE203691.1|BE203691 EST396367 KV0 Medicago truncatula cDNA clone pKV0-11O9, mRNA
sequence
Length = 398
Score = 44.1 bits (22), Expect = 0.027
Identities = 61/74 (82%)
Strand = Plus / Minus
Query: 90 aaacttgagaatgcaggtatcgaacgttcaaaagctgttgactctgctgtgctgggaaaa 149
|||||||| |||| || ||| |||||||||| | ||| ||| || || || ||||| |||
Sbjct: 110 aaacttgaaaatgaagctattgaacgttcaagatctgctgagtcagccgtactgggtaaa 51
Query: 150 tacagcatctggag 163
|||||||| |||||
Sbjct: 50 tacagcatttggag 37
>gb|CX535046.1|CX535046 s13dNF36C06MJ050_388273 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 660
Score = 44.1 bits (22), Expect = 0.027
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 167 tgaaaatgaaaatgaaaaggca 188
||||||||||||||||||||||
Sbjct: 36 tgaaaatgaaaatgaaaaggca 15
>gb|BG645289.1|BG645289 EST506908 KV3 Medicago truncatula cDNA clone pKV3-39F4 5' end, mRNA
sequence
Length = 817
Score = 42.1 bits (21), Expect = 0.11
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 166 gtgaaaatgaaaatgaaaagg 186
|||||||||||||||||||||
Sbjct: 38 gtgaaaatgaaaatgaaaagg 18
>gb|AJ500181.1|AJ500181 AJ500181 MTGIM Medicago truncatula cDNA clone mtgmacc120013f03, mRNA
sequence
Length = 614
Score = 42.1 bits (21), Expect = 0.11
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1188 cgtacctgcccgggcggccgc 1208
|||||||||||||||||||||
Sbjct: 203 cgtacctgcccgggcggccgc 223
>gb|AJ500456.1|AJ500456 AJ500456 MTGIM Medicago truncatula cDNA clone mtgmacc120016f01, mRNA
sequence
Length = 310
Score = 42.1 bits (21), Expect = 0.11
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1185 ccgcgtacctgcccgggcggc 1205
|||||||||||||||||||||
Sbjct: 290 ccgcgtacctgcccgggcggc 310
>gb|AJ499175.1|AJ499175 AJ499175 MTGIM Medicago truncatula cDNA clone mtgmacc120001a07, mRNA
sequence
Length = 366
Score = 42.1 bits (21), Expect = 0.11
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 1185 ccgcgtacctgcccgggcggccgc 1208
|||||||||||||||||||| |||
Sbjct: 338 ccgcgtacctgcccgggcggncgc 361
>gb|CA917455.1|CA917455 EST641602 GPOD Medicago truncatula cDNA clone GPOD-36O19, mRNA
sequence
Length = 729
Score = 40.1 bits (20), Expect = 0.43
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 1101 aatggaaatgtaaatggagccgtggaaacatg 1132
|||||||| || |||||||| |||||||||||
Sbjct: 660 aatggaaaagtgaatggagcagtggaaacatg 691
>gb|AJ500088.1|AJ500088 AJ500088 MTGIM Medicago truncatula cDNA clone mtgmacc120012e05, mRNA
sequence
Length = 114
Score = 40.1 bits (20), Expect = 0.43
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1185 ccgcgtacctgcccgggcggccgc 1208
||||||||||||||||||| ||||
Sbjct: 28 ccgcgtacctgcccgggcgcccgc 5
>gb|AJ500185.1|AJ500185 AJ500185 MTGIM Medicago truncatula cDNA clone mtgmacc120013f07, mRNA
sequence
Length = 557
Score = 40.1 bits (20), Expect = 0.43
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 1185 ccgcgtacctgcccgggcggccgc 1208
|||||||||||||||||| |||||
Sbjct: 28 ccgcgtacctgcccgggcagccgc 5
>gb|AJ500217.1|AJ500217 AJ500217 MTGIM Medicago truncatula cDNA clone mtgmacc120014a04, mRNA
sequence
Length = 458
Score = 40.1 bits (20), Expect = 0.43
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1189 gtacctgcccgggcggccgc 1208
||||||||||||||||||||
Sbjct: 300 gtacctgcccgggcggccgc 319
>gb|AJ500301.1|AJ500301 AJ500301 MTGIM Medicago truncatula cDNA clone mtgmacc120014h08, mRNA
sequence
Length = 164
Score = 40.1 bits (20), Expect = 0.43
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1189 gtacctgcccgggcggccgc 1208
||||||||||||||||||||
Sbjct: 45 gtacctgcccgggcggccgc 26
>gb|AJ500566.1|AJ500566 AJ500566 MTGIM Medicago truncatula cDNA clone mtgmacc120017g10, mRNA
sequence
Length = 406
Score = 40.1 bits (20), Expect = 0.43
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1189 gtacctgcccgggcggccgc 1208
||||||||||||||||||||
Sbjct: 290 gtacctgcccgggcggccgc 309
>gb|AJ500711.1|AJ500711 AJ500711 MTGIM Medicago truncatula cDNA clone mtgmacc120019d05, mRNA
sequence
Length = 591
Score = 40.1 bits (20), Expect = 0.43
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1189 gtacctgcccgggcggccgc 1208
||||||||||||||||||||
Sbjct: 339 gtacctgcccgggcggccgc 320
>gb|AJ621860.1|AJ621860 AJ621860 Medicago truncatula J5 roots Medicago truncatula cDNA clone
MtGmEs470, mRNA sequence
Length = 1151
Score = 40.1 bits (20), Expect = 0.43
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1189 gtacctgcccgggcggccgc 1208
||||||||||||||||||||
Sbjct: 297 gtacctgcccgggcggccgc 278
>gb|AJ864417.1|AJ864417 AJ864417 Medicago truncatula cv. J5 root Medicago truncatula cDNA
clone MtPfEs361, mRNA sequence
Length = 593
Score = 40.1 bits (20), Expect = 0.43
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1189 gtacctgcccgggcggccgc 1208
||||||||||||||||||||
Sbjct: 24 gtacctgcccgggcggccgc 5
>gb|AC151665.22| Medicago truncatula clone mth2-7k4, WORKING DRAFT SEQUENCE, 3 unordered
pieces
Length = 132871
Score = 40.1 bits (20), Expect = 0.43
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 167 tgaaaatgaaaatgaaaagg 186
||||||||||||||||||||
Sbjct: 92361 tgaaaatgaaaatgaaaagg 92342
>gb|AC174354.3| Medicago truncatula clone mth2-8m12, WORKING DRAFT SEQUENCE, 14 unordered
pieces
Length = 113456
Score = 40.1 bits (20), Expect = 0.43
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 167 tgaaaatgaaaatgaaaagg 186
||||||||||||||||||||
Sbjct: 101563 tgaaaatgaaaatgaaaagg 101544
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 403,043
Number of Sequences: 392609
Number of extensions: 403043
Number of successful extensions: 32920
Number of sequences better than 0.5: 29
Number of HSP's better than 0.5 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32822
Number of HSP's gapped (non-prelim): 95
length of query: 1208
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1188
effective length of database: 433,880,813
effective search space: 515450405844
effective search space used: 515450405844
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)