BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3173057.2.1
         (1264 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BE943299.1|BE943299  EST422878 MGHG Medicago truncatula c...    50   5e-004
gb|BI269436.1|BI269436  NF015G03IR1F1023 Irradiated Medicago...    50   5e-004
gb|CA920658.1|CA920658  EST638376 MTUS Medicago truncatula c...    50   5e-004
gb|CX539437.1|CX539437  s13dNF70H11GS092_462134 Germinating ...    50   5e-004
gb|CX540377.1|CX540377  s13dNF74D11GS093_464028 Germinating ...    50   5e-004

>gb|BE943299.1|BE943299 EST422878 MGHG Medicago truncatula cDNA clone pMGHG-15I8, mRNA
           sequence
          Length = 540

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 770 acacccgatttgtagagctggaactcccggccaccggcctcaatggcaacgct 822
           ||||||||||  ||||| || ||  ||||||||||||||||||| ||||||||
Sbjct: 399 acacccgattgatagagttgcaaagcccggccaccggcctcaatagcaacgct 347




 Score = 48.1 bits (24), Expect = 0.002
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 875 acatcttcaaagccatcgatgctcacaaccctggcatttttcct 918
           ||||||||| | ||||| |||||||| ||| |||||||||||||
Sbjct: 294 acatcttcatatccatcaatgctcactaccttggcatttttcct 251



>gb|BI269436.1|BI269436 NF015G03IR1F1023 Irradiated Medicago truncatula cDNA clone
           NF015G03IR 5', mRNA sequence
          Length = 362

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 770 acacccgatttgtagagctggaactcccggccaccggcctcaatggcaacgct 822
           ||||||||||  ||||| || ||  ||||||||||||||||||| ||||||||
Sbjct: 174 acacccgattgatagagttgcaaagcccggccaccggcctcaatagcaacgct 122




 Score = 48.1 bits (24), Expect = 0.002
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 875 acatcttcaaagccatcgatgctcacaaccctggcatttttcct 918
           ||||||||| | ||||| |||||||| ||| |||||||||||||
Sbjct: 69  acatcttcatatccatcaatgctcactaccttggcatttttcct 26



>gb|CA920658.1|CA920658 EST638376 MTUS Medicago truncatula cDNA clone MTUS-30G8, mRNA
           sequence
          Length = 538

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 770 acacccgatttgtagagctggaactcccggccaccggcctcaatggcaacgct 822
           ||||||||||  ||||| || ||  ||||||||||||||||||| ||||||||
Sbjct: 474 acacccgattgatagagttgcaaagcccggccaccggcctcaatagcaacgct 526



>gb|CX539437.1|CX539437 s13dNF70H11GS092_462134 Germinating Seed Medicago truncatula cDNA,
           mRNA sequence
          Length = 493

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 770 acacccgatttgtagagctggaactcccggccaccggcctcaatggcaacgct 822
           ||||||||||  ||||| || ||  ||||||||||||||||||| ||||||||
Sbjct: 425 acacccgattgatagagttgcaaagcccggccaccggcctcaatagcaacgct 373




 Score = 48.1 bits (24), Expect = 0.002
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 875 acatcttcaaagccatcgatgctcacaaccctggcatttttcct 918
           ||||||||| | ||||| |||||||| ||| |||||||||||||
Sbjct: 320 acatcttcatatccatcaatgctcactaccttggcatttttcct 277



>gb|CX540377.1|CX540377 s13dNF74D11GS093_464028 Germinating Seed Medicago truncatula cDNA,
           mRNA sequence
          Length = 511

 Score = 50.1 bits (25), Expect = 5e-004
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 770 acacccgatttgtagagctggaactcccggccaccggcctcaatggcaacgct 822
           ||||||||||  ||||| || ||  ||||||||||||||||||| ||||||||
Sbjct: 113 acacccgattgatagagttgcaaagcccggccaccggcctcaatagcaacgct 61



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 150,577
Number of Sequences: 392609
Number of extensions: 150577
Number of successful extensions: 10477
Number of sequences better than  0.5: 5
Number of HSP's better than  0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10469
Number of HSP's gapped (non-prelim): 8
length of query: 1264
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1244
effective length of database: 433,880,813
effective search space: 539747731372
effective search space used: 539747731372
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)