BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3147935.2.1
(711 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CG926803.1|CG926803 MBENN82TR mth2 Medicago truncatula g... 40 0.25
gb|AC149495.23| Medicago truncatula clone mth2-117o14, WORK... 40 0.25
>gb|CG926803.1|CG926803 MBENN82TR mth2 Medicago truncatula genomic clone 9M20, DNA sequence
Length = 885
Score = 40.1 bits (20), Expect = 0.25
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 208 ttttgttcttccttttttgctttt 231
||||||||||||||| ||||||||
Sbjct: 194 ttttgttcttcctttcttgctttt 217
>gb|AC149495.23| Medicago truncatula clone mth2-117o14, WORKING DRAFT SEQUENCE, 5
ordered pieces
Length = 122240
Score = 40.1 bits (20), Expect = 0.25
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 208 ttttgttcttccttttttgctttt 231
||||||||||||||| ||||||||
Sbjct: 99756 ttttgttcttcctttcttgctttt 99733
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 144,919
Number of Sequences: 392609
Number of extensions: 144919
Number of successful extensions: 10284
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10282
Number of HSP's gapped (non-prelim): 2
length of query: 711
length of database: 441,732,993
effective HSP length: 19
effective length of query: 692
effective length of database: 434,273,422
effective search space: 300517208024
effective search space used: 300517208024
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)