BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3147935.2.1
         (711 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CG926803.1|CG926803  MBENN82TR mth2 Medicago truncatula g...    40   0.25 
gb|AC149495.23|  Medicago truncatula clone mth2-117o14, WORK...    40   0.25 

>gb|CG926803.1|CG926803 MBENN82TR mth2 Medicago truncatula genomic clone 9M20, DNA sequence
          Length = 885

 Score = 40.1 bits (20), Expect = 0.25
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 208 ttttgttcttccttttttgctttt 231
           ||||||||||||||| ||||||||
Sbjct: 194 ttttgttcttcctttcttgctttt 217



>gb|AC149495.23| Medicago truncatula clone mth2-117o14, WORKING DRAFT SEQUENCE, 5
             ordered pieces
          Length = 122240

 Score = 40.1 bits (20), Expect = 0.25
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 208   ttttgttcttccttttttgctttt 231
             ||||||||||||||| ||||||||
Sbjct: 99756 ttttgttcttcctttcttgctttt 99733



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 144,919
Number of Sequences: 392609
Number of extensions: 144919
Number of successful extensions: 10284
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10282
Number of HSP's gapped (non-prelim): 2
length of query: 711
length of database: 441,732,993
effective HSP length: 19
effective length of query: 692
effective length of database: 434,273,422
effective search space: 300517208024
effective search space used: 300517208024
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)