BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3128444.2.1
         (857 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AW561018.1|AW561018  EST316066 DSIR Medicago truncatula c...    46   0.005
gb|BF647601.1|BF647601  NF012A07EC1F1051 Elicited cell cultu...    44   0.019
gb|AC136138.30|  Medicago truncatula clone mth2-8f9, complet...    44   0.019

>gb|AW561018.1|AW561018 EST316066 DSIR Medicago truncatula cDNA clone pDSIR-31G21, mRNA
           sequence
          Length = 649

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 535 tacttcgcgtggtcattcctggacaacttcgagtgggct 573
           ||||| || |||||||| |||||||||||||| ||||||
Sbjct: 136 tactttgcatggtcattactggacaacttcgaatgggct 174



>gb|BF647601.1|BF647601 NF012A07EC1F1051 Elicited cell culture Medicago truncatula cDNA
           clone NF012A07EC 5', mRNA sequence
          Length = 581

 Score = 44.1 bits (22), Expect = 0.019
 Identities = 64/78 (82%)
 Strand = Plus / Plus

                                                                       
Query: 496 gttgcgcaggcgatcaaggacggggctgatgtccgtgggtacttcgcgtggtcattcctg 555
           ||||||||||| || ||||| || ||||||||  | ||  |||| || |||||||| |||
Sbjct: 409 gttgcgcaggctataaaggatggagctgatgtgagaggacactttgcatggtcattactg 468

                             
Query: 556 gacaacttcgagtgggct 573
           || |||||||| ||||||
Sbjct: 469 gataacttcgaatgggct 486



>gb|AC136138.30| Medicago truncatula clone mth2-8f9, complete sequence
          Length = 128267

 Score = 44.1 bits (22), Expect = 0.019
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 168   ttttattggactaaatcattatactt 193
             |||||||||||| |||||||||||||
Sbjct: 47352 ttttattggactgaatcattatactt 47327



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 213,400
Number of Sequences: 392609
Number of extensions: 213400
Number of successful extensions: 18072
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 18064
Number of HSP's gapped (non-prelim): 10
length of query: 857
length of database: 441,732,993
effective HSP length: 20
effective length of query: 837
effective length of database: 433,880,813
effective search space: 363158240481
effective search space used: 363158240481
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)