BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3115190.2.2
(1172 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC122726.21| Medicago truncatula clone mth2-23o24, compl... 48 0.002
gb|AC146776.31| Medicago truncatula clone mth2-125i24, WORK... 48 0.002
>gb|AC122726.21| Medicago truncatula clone mth2-23o24, complete sequence
Length = 130999
Score = 48.1 bits (24), Expect = 0.002
Identities = 63/76 (82%)
Strand = Plus / Plus
Query: 470 ggatgccaaggtgccgctggggcttcttccacgttgtcaacaacgactacacgcactggc 529
||||||||||||| | ||||| ||||| || |||| ||||| |||||||| || ||||
Sbjct: 9643 ggatgccaaggtgtagatggggattctttcatattgttaacaatgactacactcattggc 9702
Query: 530 tcatgtacgccattgg 545
| ||||| ||||||||
Sbjct: 9703 ttatgtatgccattgg 9718
>gb|AC146776.31| Medicago truncatula clone mth2-125i24, WORKING DRAFT SEQUENCE, 2
unordered pieces
Length = 132037
Score = 48.1 bits (24), Expect = 0.002
Identities = 63/76 (82%)
Strand = Plus / Minus
Query: 470 ggatgccaaggtgccgctggggcttcttccacgttgtcaacaacgactacacgcactggc 529
||||||||||||| | ||||| ||||| || |||| ||||| |||||||| || ||||
Sbjct: 82821 ggatgccaaggtgtagatggggattctttcatattgttaacaatgactacactcattggc 82762
Query: 530 tcatgtacgccattgg 545
| ||||| ||||||||
Sbjct: 82761 ttatgtatgccattgg 82746
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 196,716
Number of Sequences: 392609
Number of extensions: 196716
Number of successful extensions: 15305
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 15292
Number of HSP's gapped (non-prelim): 13
length of query: 1172
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1152
effective length of database: 433,880,813
effective search space: 499830696576
effective search space used: 499830696576
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)