BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3115190.2.2
         (1172 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC122726.21|  Medicago truncatula clone mth2-23o24, compl...    48   0.002
gb|AC146776.31|  Medicago truncatula clone mth2-125i24, WORK...    48   0.002

>gb|AC122726.21| Medicago truncatula clone mth2-23o24, complete sequence
          Length = 130999

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 63/76 (82%)
 Strand = Plus / Plus

                                                                        
Query: 470  ggatgccaaggtgccgctggggcttcttccacgttgtcaacaacgactacacgcactggc 529
            |||||||||||||  | ||||| ||||| ||  |||| ||||| |||||||| || ||||
Sbjct: 9643 ggatgccaaggtgtagatggggattctttcatattgttaacaatgactacactcattggc 9702

                            
Query: 530  tcatgtacgccattgg 545
            | ||||| ||||||||
Sbjct: 9703 ttatgtatgccattgg 9718



>gb|AC146776.31| Medicago truncatula clone mth2-125i24, WORKING DRAFT SEQUENCE, 2
             unordered pieces
          Length = 132037

 Score = 48.1 bits (24), Expect = 0.002
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                         
Query: 470   ggatgccaaggtgccgctggggcttcttccacgttgtcaacaacgactacacgcactggc 529
             |||||||||||||  | ||||| ||||| ||  |||| ||||| |||||||| || ||||
Sbjct: 82821 ggatgccaaggtgtagatggggattctttcatattgttaacaatgactacactcattggc 82762

                             
Query: 530   tcatgtacgccattgg 545
             | ||||| ||||||||
Sbjct: 82761 ttatgtatgccattgg 82746



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 196,716
Number of Sequences: 392609
Number of extensions: 196716
Number of successful extensions: 15305
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 15292
Number of HSP's gapped (non-prelim): 13
length of query: 1172
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1152
effective length of database: 433,880,813
effective search space: 499830696576
effective search space used: 499830696576
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)