BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3071743.2.1
         (586 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC135461.11|  Medicago truncatula clone mth2-34f24, compl...    40   0.20 
gb|AC150246.1|  Medicago truncatula chromosome 2 clone mth2-...    40   0.20 
gb|AC137701.25|  Medicago truncatula clone mth2-35h1, comple...    40   0.20 

>gb|AC135461.11| Medicago truncatula clone mth2-34f24, complete sequence
          Length = 132875

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 544   tatcatgtgaagagccatctgcag 567
             ||||||||||| ||||||||||||
Sbjct: 29420 tatcatgtgaaaagccatctgcag 29397



>gb|AC150246.1| Medicago truncatula chromosome 2 clone mth2-4c5, *** SEQUENCING IN
            PROGRESS ***, 4 ordered pieces
          Length = 94212

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 544  tatcatgtgaagagccatctgcag 567
            ||||||||||| ||||||||||||
Sbjct: 7898 tatcatgtgaaaagccatctgcag 7921



>gb|AC137701.25| Medicago truncatula clone mth2-35h1, complete sequence
          Length = 151417

 Score = 40.1 bits (20), Expect = 0.20
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 544    tatcatgtgaagagccatctgcag 567
              ||||||||||| ||||||||||||
Sbjct: 135095 tatcatgtgaaaagccatctgcag 135118



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 138,517
Number of Sequences: 392609
Number of extensions: 138517
Number of successful extensions: 8652
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8640
Number of HSP's gapped (non-prelim): 12
length of query: 586
length of database: 441,732,993
effective HSP length: 19
effective length of query: 567
effective length of database: 434,273,422
effective search space: 246233030274
effective search space used: 246233030274
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)