BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3067516.2.1
         (605 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CG922569.1|CG922569  MBEIP40TR mth2 Medicago truncatula g...    42   0.053
gb|BI309179.1|BI309179  EST530589 GPOD Medicago truncatula c...    42   0.053
gb|AC148607.16|  Medicago truncatula clone mth2-43g15, compl...    42   0.053
gb|AC171532.4|  Medicago truncatula chromosome 7 clone mth2-...    42   0.053

>gb|CG922569.1|CG922569 MBEIP40TR mth2 Medicago truncatula genomic clone 63H8, DNA sequence
          Length = 943

 Score = 42.1 bits (21), Expect = 0.053
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 456 gaaacatcaaatgcatctttcaatgtctc 484
           ||||||||||| ||||||||||| |||||
Sbjct: 656 gaaacatcaaaagcatctttcaaagtctc 628



>gb|BI309179.1|BI309179 EST530589 GPOD Medicago truncatula cDNA clone pGPOD-10N18 5' end,
           mRNA sequence
          Length = 545

 Score = 42.1 bits (21), Expect = 0.053
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 456 gaaacatcaaatgcatctttcaatgtctc 484
           ||||||||||| ||||||||||| |||||
Sbjct: 242 gaaacatcaaaagcatctttcaaagtctc 214



>gb|AC148607.16| Medicago truncatula clone mth2-43g15, complete sequence
          Length = 148291

 Score = 42.1 bits (21), Expect = 0.053
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 456   gaaacatcaaatgcatctttcaatgtctc 484
             ||||||||||| ||||||||||| |||||
Sbjct: 21875 gaaacatcaaaagcatctttcaaagtctc 21847



>gb|AC171532.4| Medicago truncatula chromosome 7 clone mth2-5a15, *** SEQUENCING IN
              PROGRESS ***, 2 ordered pieces
          Length = 139550

 Score = 42.1 bits (21), Expect = 0.053
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 456    gaaacatcaaatgcatctttcaatgtctc 484
              ||||||||||| ||||||||||| |||||
Sbjct: 123807 gaaacatcaaaagcatctttcaaagtctc 123779



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 190,652
Number of Sequences: 392609
Number of extensions: 190652
Number of successful extensions: 14094
Number of sequences better than  0.5: 4
Number of HSP's better than  0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14077
Number of HSP's gapped (non-prelim): 17
length of query: 605
length of database: 441,732,993
effective HSP length: 19
effective length of query: 586
effective length of database: 434,273,422
effective search space: 254484225292
effective search space used: 254484225292
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)